ID: 909025587

View in Genome Browser
Species Human (GRCh38)
Location 1:70478054-70478076
Sequence CTTTGTAAGCACATGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909025587_909025592 20 Left 909025587 1:70478054-70478076 CCTTCATCCATGTGCTTACAAAG No data
Right 909025592 1:70478097-70478119 TATGGCTGCATAGTATTCCATGG 0: 24516
1: 14054
2: 8260
3: 5392
4: 3574
909025587_909025590 2 Left 909025587 1:70478054-70478076 CCTTCATCCATGTGCTTACAAAG No data
Right 909025590 1:70478079-70478101 CATGAACTCATCCTTTTTTATGG 0: 6520
1: 16826
2: 7677
3: 5376
4: 6414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909025587 Original CRISPR CTTTGTAAGCACATGGATGA AGG (reversed) Intergenic
No off target data available for this crispr