ID: 909027273

View in Genome Browser
Species Human (GRCh38)
Location 1:70496768-70496790
Sequence TCTCTTTGCTTTGGCAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909027273_909027275 7 Left 909027273 1:70496768-70496790 CCACTGCTGCCAAAGCAAAGAGA No data
Right 909027275 1:70496798-70496820 TTCAGCTACCACTATATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909027273 Original CRISPR TCTCTTTGCTTTGGCAGCAG TGG (reversed) Intergenic