ID: 909027275

View in Genome Browser
Species Human (GRCh38)
Location 1:70496798-70496820
Sequence TTCAGCTACCACTATATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909027271_909027275 21 Left 909027271 1:70496754-70496776 CCATTCGATAGCCACCACTGCTG No data
Right 909027275 1:70496798-70496820 TTCAGCTACCACTATATGAAAGG No data
909027270_909027275 22 Left 909027270 1:70496753-70496775 CCCATTCGATAGCCACCACTGCT No data
Right 909027275 1:70496798-70496820 TTCAGCTACCACTATATGAAAGG No data
909027272_909027275 10 Left 909027272 1:70496765-70496787 CCACCACTGCTGCCAAAGCAAAG No data
Right 909027275 1:70496798-70496820 TTCAGCTACCACTATATGAAAGG No data
909027273_909027275 7 Left 909027273 1:70496768-70496790 CCACTGCTGCCAAAGCAAAGAGA No data
Right 909027275 1:70496798-70496820 TTCAGCTACCACTATATGAAAGG No data
909027274_909027275 -2 Left 909027274 1:70496777-70496799 CCAAAGCAAAGAGAAAACTTTTT No data
Right 909027275 1:70496798-70496820 TTCAGCTACCACTATATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909027275 Original CRISPR TTCAGCTACCACTATATGAA AGG Intergenic
No off target data available for this crispr