ID: 909030755

View in Genome Browser
Species Human (GRCh38)
Location 1:70536793-70536815
Sequence TTTGATGACTATAACGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909030755_909030760 -6 Left 909030755 1:70536793-70536815 CCCACCCCGTTATAGTCATCAAA No data
Right 909030760 1:70536810-70536832 ATCAAAAAGAAAAAGTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909030755 Original CRISPR TTTGATGACTATAACGGGGT GGG (reversed) Intergenic
No off target data available for this crispr