ID: 909042905

View in Genome Browser
Species Human (GRCh38)
Location 1:70675400-70675422
Sequence ACTCACCTTTTAGTATTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042905_909042914 29 Left 909042905 1:70675400-70675422 CCTAGTAATACTAAAAGGTGAGT No data
Right 909042914 1:70675452-70675474 GAGCCCCAATTGTGTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042905 Original CRISPR ACTCACCTTTTAGTATTACT AGG (reversed) Intergenic
No off target data available for this crispr