ID: 909042908

View in Genome Browser
Species Human (GRCh38)
Location 1:70675430-70675452
Sequence CTGTTAGGGAAGAAGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042908_909042921 27 Left 909042908 1:70675430-70675452 CCTCCCCTCTTCTTCCCTAACAG No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042908_909042920 26 Left 909042908 1:70675430-70675452 CCTCCCCTCTTCTTCCCTAACAG No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042908_909042917 3 Left 909042908 1:70675430-70675452 CCTCCCCTCTTCTTCCCTAACAG No data
Right 909042917 1:70675456-70675478 CCCAATTGTGTCCTGATGGCAGG No data
909042908_909042914 -1 Left 909042908 1:70675430-70675452 CCTCCCCTCTTCTTCCCTAACAG No data
Right 909042914 1:70675452-70675474 GAGCCCCAATTGTGTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042908 Original CRISPR CTGTTAGGGAAGAAGAGGGG AGG (reversed) Intergenic