ID: 909042909

View in Genome Browser
Species Human (GRCh38)
Location 1:70675433-70675455
Sequence GCTCTGTTAGGGAAGAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042909_909042920 23 Left 909042909 1:70675433-70675455 CCCCTCTTCTTCCCTAACAGAGC No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042909_909042914 -4 Left 909042909 1:70675433-70675455 CCCCTCTTCTTCCCTAACAGAGC No data
Right 909042914 1:70675452-70675474 GAGCCCCAATTGTGTCCTGATGG No data
909042909_909042921 24 Left 909042909 1:70675433-70675455 CCCCTCTTCTTCCCTAACAGAGC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042909_909042917 0 Left 909042909 1:70675433-70675455 CCCCTCTTCTTCCCTAACAGAGC No data
Right 909042917 1:70675456-70675478 CCCAATTGTGTCCTGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042909 Original CRISPR GCTCTGTTAGGGAAGAAGAG GGG (reversed) Intergenic
No off target data available for this crispr