ID: 909042912

View in Genome Browser
Species Human (GRCh38)
Location 1:70675444-70675466
Sequence ACACAATTGGGGCTCTGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042912_909042920 12 Left 909042912 1:70675444-70675466 CCCTAACAGAGCCCCAATTGTGT No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042912_909042921 13 Left 909042912 1:70675444-70675466 CCCTAACAGAGCCCCAATTGTGT No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042912 Original CRISPR ACACAATTGGGGCTCTGTTA GGG (reversed) Intergenic
No off target data available for this crispr