ID: 909042913

View in Genome Browser
Species Human (GRCh38)
Location 1:70675445-70675467
Sequence GACACAATTGGGGCTCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042913_909042921 12 Left 909042913 1:70675445-70675467 CCTAACAGAGCCCCAATTGTGTC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042913_909042920 11 Left 909042913 1:70675445-70675467 CCTAACAGAGCCCCAATTGTGTC No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042913 Original CRISPR GACACAATTGGGGCTCTGTT AGG (reversed) Intergenic
No off target data available for this crispr