ID: 909042914

View in Genome Browser
Species Human (GRCh38)
Location 1:70675452-70675474
Sequence GAGCCCCAATTGTGTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042905_909042914 29 Left 909042905 1:70675400-70675422 CCTAGTAATACTAAAAGGTGAGT No data
Right 909042914 1:70675452-70675474 GAGCCCCAATTGTGTCCTGATGG No data
909042908_909042914 -1 Left 909042908 1:70675430-70675452 CCTCCCCTCTTCTTCCCTAACAG No data
Right 909042914 1:70675452-70675474 GAGCCCCAATTGTGTCCTGATGG No data
909042910_909042914 -5 Left 909042910 1:70675434-70675456 CCCTCTTCTTCCCTAACAGAGCC No data
Right 909042914 1:70675452-70675474 GAGCCCCAATTGTGTCCTGATGG No data
909042909_909042914 -4 Left 909042909 1:70675433-70675455 CCCCTCTTCTTCCCTAACAGAGC No data
Right 909042914 1:70675452-70675474 GAGCCCCAATTGTGTCCTGATGG No data
909042911_909042914 -6 Left 909042911 1:70675435-70675457 CCTCTTCTTCCCTAACAGAGCCC No data
Right 909042914 1:70675452-70675474 GAGCCCCAATTGTGTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042914 Original CRISPR GAGCCCCAATTGTGTCCTGA TGG Intergenic
No off target data available for this crispr