ID: 909042917

View in Genome Browser
Species Human (GRCh38)
Location 1:70675456-70675478
Sequence CCCAATTGTGTCCTGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042908_909042917 3 Left 909042908 1:70675430-70675452 CCTCCCCTCTTCTTCCCTAACAG No data
Right 909042917 1:70675456-70675478 CCCAATTGTGTCCTGATGGCAGG No data
909042910_909042917 -1 Left 909042910 1:70675434-70675456 CCCTCTTCTTCCCTAACAGAGCC No data
Right 909042917 1:70675456-70675478 CCCAATTGTGTCCTGATGGCAGG No data
909042911_909042917 -2 Left 909042911 1:70675435-70675457 CCTCTTCTTCCCTAACAGAGCCC No data
Right 909042917 1:70675456-70675478 CCCAATTGTGTCCTGATGGCAGG No data
909042909_909042917 0 Left 909042909 1:70675433-70675455 CCCCTCTTCTTCCCTAACAGAGC No data
Right 909042917 1:70675456-70675478 CCCAATTGTGTCCTGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042917 Original CRISPR CCCAATTGTGTCCTGATGGC AGG Intergenic
No off target data available for this crispr