ID: 909042918

View in Genome Browser
Species Human (GRCh38)
Location 1:70675457-70675479
Sequence GCCTGCCATCAGGACACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042918_909042921 0 Left 909042918 1:70675457-70675479 CCAATTGTGTCCTGATGGCAGGC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042918_909042920 -1 Left 909042918 1:70675457-70675479 CCAATTGTGTCCTGATGGCAGGC No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042918 Original CRISPR GCCTGCCATCAGGACACAAT TGG (reversed) Intergenic
No off target data available for this crispr