ID: 909042920

View in Genome Browser
Species Human (GRCh38)
Location 1:70675479-70675501
Sequence CAGCTCTGTGCACCTTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042916_909042920 0 Left 909042916 1:70675456-70675478 CCCAATTGTGTCCTGATGGCAGG No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042911_909042920 21 Left 909042911 1:70675435-70675457 CCTCTTCTTCCCTAACAGAGCCC No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042909_909042920 23 Left 909042909 1:70675433-70675455 CCCCTCTTCTTCCCTAACAGAGC No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042913_909042920 11 Left 909042913 1:70675445-70675467 CCTAACAGAGCCCCAATTGTGTC No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042918_909042920 -1 Left 909042918 1:70675457-70675479 CCAATTGTGTCCTGATGGCAGGC No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042910_909042920 22 Left 909042910 1:70675434-70675456 CCCTCTTCTTCCCTAACAGAGCC No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042908_909042920 26 Left 909042908 1:70675430-70675452 CCTCCCCTCTTCTTCCCTAACAG No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042912_909042920 12 Left 909042912 1:70675444-70675466 CCCTAACAGAGCCCCAATTGTGT No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data
909042915_909042920 1 Left 909042915 1:70675455-70675477 CCCCAATTGTGTCCTGATGGCAG No data
Right 909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042920 Original CRISPR CAGCTCTGTGCACCTTGCAG AGG Intergenic
No off target data available for this crispr