ID: 909042921

View in Genome Browser
Species Human (GRCh38)
Location 1:70675480-70675502
Sequence AGCTCTGTGCACCTTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909042909_909042921 24 Left 909042909 1:70675433-70675455 CCCCTCTTCTTCCCTAACAGAGC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042912_909042921 13 Left 909042912 1:70675444-70675466 CCCTAACAGAGCCCCAATTGTGT No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042915_909042921 2 Left 909042915 1:70675455-70675477 CCCCAATTGTGTCCTGATGGCAG No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042908_909042921 27 Left 909042908 1:70675430-70675452 CCTCCCCTCTTCTTCCCTAACAG No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042919_909042921 -10 Left 909042919 1:70675467-70675489 CCTGATGGCAGGCAGCTCTGTGC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042913_909042921 12 Left 909042913 1:70675445-70675467 CCTAACAGAGCCCCAATTGTGTC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042916_909042921 1 Left 909042916 1:70675456-70675478 CCCAATTGTGTCCTGATGGCAGG No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042911_909042921 22 Left 909042911 1:70675435-70675457 CCTCTTCTTCCCTAACAGAGCCC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042918_909042921 0 Left 909042918 1:70675457-70675479 CCAATTGTGTCCTGATGGCAGGC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data
909042910_909042921 23 Left 909042910 1:70675434-70675456 CCCTCTTCTTCCCTAACAGAGCC No data
Right 909042921 1:70675480-70675502 AGCTCTGTGCACCTTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909042921 Original CRISPR AGCTCTGTGCACCTTGCAGA GGG Intergenic
No off target data available for this crispr