ID: 909046606

View in Genome Browser
Species Human (GRCh38)
Location 1:70718186-70718208
Sequence CTCTGAAATCAGATGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909046606_909046610 1 Left 909046606 1:70718186-70718208 CCCAGTTCCATCTGATTTCAGAG No data
Right 909046610 1:70718210-70718232 CTAAACTCCTACTCAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909046606 Original CRISPR CTCTGAAATCAGATGGAACT GGG (reversed) Intergenic
No off target data available for this crispr