ID: 909051988

View in Genome Browser
Species Human (GRCh38)
Location 1:70777197-70777219
Sequence GGGCAGGTTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909051988_909051993 10 Left 909051988 1:70777197-70777219 CCTCAATTTGCATTAACCTGCCC No data
Right 909051993 1:70777230-70777252 ATGTAATTGAAAGCGAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909051988 Original CRISPR GGGCAGGTTAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr