ID: 909051993

View in Genome Browser
Species Human (GRCh38)
Location 1:70777230-70777252
Sequence ATGTAATTGAAAGCGAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909051989_909051993 -6 Left 909051989 1:70777213-70777235 CCTGCCCCTTAATTTGCATGTAA 0: 19
1: 53
2: 86
3: 107
4: 240
Right 909051993 1:70777230-70777252 ATGTAATTGAAAGCGAGTAGAGG No data
909051988_909051993 10 Left 909051988 1:70777197-70777219 CCTCAATTTGCATTAACCTGCCC No data
Right 909051993 1:70777230-70777252 ATGTAATTGAAAGCGAGTAGAGG No data
909051985_909051993 16 Left 909051985 1:70777191-70777213 CCCGTCCCTCAATTTGCATTAAC No data
Right 909051993 1:70777230-70777252 ATGTAATTGAAAGCGAGTAGAGG No data
909051990_909051993 -10 Left 909051990 1:70777217-70777239 CCCCTTAATTTGCATGTAATTGA 0: 23
1: 105
2: 207
3: 313
4: 484
Right 909051993 1:70777230-70777252 ATGTAATTGAAAGCGAGTAGAGG No data
909051986_909051993 15 Left 909051986 1:70777192-70777214 CCGTCCCTCAATTTGCATTAACC No data
Right 909051993 1:70777230-70777252 ATGTAATTGAAAGCGAGTAGAGG No data
909051987_909051993 11 Left 909051987 1:70777196-70777218 CCCTCAATTTGCATTAACCTGCC No data
Right 909051993 1:70777230-70777252 ATGTAATTGAAAGCGAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909051993 Original CRISPR ATGTAATTGAAAGCGAGTAG AGG Intergenic
No off target data available for this crispr