ID: 909053051

View in Genome Browser
Species Human (GRCh38)
Location 1:70790639-70790661
Sequence CTGTGGGACAACCTGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909053048_909053051 20 Left 909053048 1:70790596-70790618 CCTGGGGCATTTTCTGTGTGACA No data
Right 909053051 1:70790639-70790661 CTGTGGGACAACCTGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909053051 Original CRISPR CTGTGGGACAACCTGCAGAG TGG Intergenic
No off target data available for this crispr