ID: 909056133

View in Genome Browser
Species Human (GRCh38)
Location 1:70823319-70823341
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909056133_909056139 -7 Left 909056133 1:70823319-70823341 CCCCTGAAGACCACCTTGGGAAG No data
Right 909056139 1:70823335-70823357 TGGGAAGGTTCTGTACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909056133 Original CRISPR CTTCCCAAGGTGGTCTTCAG GGG (reversed) Intergenic
No off target data available for this crispr