ID: 909056228

View in Genome Browser
Species Human (GRCh38)
Location 1:70824540-70824562
Sequence CTGGAGACATAGTCGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909056228_909056235 8 Left 909056228 1:70824540-70824562 CCTGGCCCCGACTATGTCTCCAG No data
Right 909056235 1:70824571-70824593 CTTCCAGTTCCTAACACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909056228 Original CRISPR CTGGAGACATAGTCGGGGCC AGG (reversed) Intergenic
No off target data available for this crispr