ID: 909060329

View in Genome Browser
Species Human (GRCh38)
Location 1:70871710-70871732
Sequence CTCTAGCTCATTAGGTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909060329_909060332 24 Left 909060329 1:70871710-70871732 CCTTATTACCTAATGAGCTAGAG No data
Right 909060332 1:70871757-70871779 AACCTTCCTCTATCCTGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909060329 Original CRISPR CTCTAGCTCATTAGGTAATA AGG (reversed) Intronic
No off target data available for this crispr