ID: 909062905

View in Genome Browser
Species Human (GRCh38)
Location 1:70899678-70899700
Sequence TTATGCTAGTAGTTGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909062905 Original CRISPR TTATGCTAGTAGTTGTGTGA AGG Intronic
900072471 1:782694-782716 TTCTTCTAGTAGTTCTGAGATGG + Intergenic
905881209 1:41465088-41465110 TTATCCTAGTACTTGTGACATGG - Intergenic
907620760 1:55976329-55976351 TCATACTAATAGGTGTGTGATGG - Intergenic
908920349 1:69183545-69183567 TTGTGATAGTAGGTGTGTGATGG + Intergenic
909062905 1:70899678-70899700 TTATGCTAGTAGTTGTGTGAAGG + Intronic
911571447 1:99522013-99522035 TTATTATAGTACTTGTCTGATGG - Intergenic
912870988 1:113305899-113305921 TTATGCTAGTGTTTGTTTTATGG + Intergenic
916581230 1:166111119-166111141 CTATGCTAGTGTTTGTGGGATGG - Intronic
917170917 1:172173075-172173097 TTATTCTGGTAGAGGTGTGAAGG + Intronic
917326432 1:173837245-173837267 CTATGGTAGTAGATGTGAGAGGG + Intronic
920349669 1:205329516-205329538 CTAAGCTAGTGGCTGTGTGAGGG + Intergenic
922267412 1:223996651-223996673 TTCTTCTAGTAGTTCTGAGATGG + Intergenic
1065368128 10:24954013-24954035 TTCTCCTAGTAATTGTGAGAGGG + Intergenic
1066577058 10:36837499-36837521 TTATGCTTCTAGTTTTGTGTTGG - Intergenic
1066726298 10:38398950-38398972 TTCTTCTAGTAGTTCTGAGATGG - Intergenic
1067315774 10:45160746-45160768 GTATGCTAATAATTGAGTGATGG + Intergenic
1068281006 10:54869809-54869831 ATGTGCTAGTGGTTCTGTGAAGG - Intronic
1068344617 10:55758200-55758222 TTATTCTAGTAGGTGTGGAATGG - Intergenic
1070861926 10:79676136-79676158 TTATTCTAGTAGGTGTGGAATGG + Intergenic
1070875217 10:79798449-79798471 TTATTCTAGTAGGTGTGGAATGG - Intergenic
1071642146 10:87320621-87320643 TTATTCTAGTAGGTGTGGAATGG - Intergenic
1073537026 10:104286779-104286801 TTATTCTATTATTTATGTGATGG - Intronic
1075533866 10:123254332-123254354 TGATGATAGTAGTGGTGCGATGG - Intergenic
1080841085 11:35984161-35984183 TTTTGCAATTAGTAGTGTGAGGG - Intronic
1081756182 11:45546352-45546374 TTATGCTTGATGTTGTGTGAGGG + Intergenic
1082159241 11:48867582-48867604 TTCTTCTAGTCTTTGTGTGAAGG - Intergenic
1085694965 11:78696525-78696547 TTGTGCTAGGACTTTTGTGAGGG + Intronic
1086675081 11:89595554-89595576 TTATACCTGTAGTTGGGTGATGG + Intergenic
1093108210 12:15115519-15115541 TTATGCTATTATTAGTGTGTGGG - Intronic
1093886273 12:24465069-24465091 ATGTGCCAGTAATTGTGTGAAGG + Intergenic
1100154402 12:91780789-91780811 TTATGTAAGTCTTTGTGTGAAGG + Intergenic
1100842545 12:98628340-98628362 TTAGTCTAGTAGTAGTGTGTAGG - Intronic
1101193636 12:102360686-102360708 TTATGCTAGTCTTTCTGTCAGGG - Intergenic
1102253146 12:111401168-111401190 GCATGATAGTAGTTGGGTGAAGG - Intergenic
1107265868 13:38553721-38553743 TGATGCTAGTAGATGTTTTAGGG + Intergenic
1108397407 13:50003633-50003655 TTATTTTAGTGGTTGTGTTATGG + Intronic
1109148855 13:58818401-58818423 TTATGCATGTAGTTCTCTGATGG - Intergenic
1109854801 13:68112444-68112466 TTATTCTAGTAGTTTTTTGGTGG - Intergenic
1110306389 13:73992288-73992310 TTATGCTGGTATTTGTGAGCAGG + Intronic
1110841629 13:80150589-80150611 TTATGCCTGTAGTTCTCTGATGG - Intergenic
1111097176 13:83532335-83532357 TTATACTTGCAGTTGTCTGAAGG - Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1117135820 14:52733347-52733369 TTATGCTACCAGATGTGTGGGGG + Intronic
1118674337 14:68166944-68166966 TTAAGGTAGTAATTGTGGGATGG - Intronic
1120639415 14:86992133-86992155 CCATGCTAGTAGTTGTCTGGTGG + Intergenic
1120900171 14:89568708-89568730 TTATGCTAGTTGTTGGGTTATGG - Intronic
1121167490 14:91819869-91819891 TTATTTTAGTGGTTGTGTTAGGG - Intronic
1129551697 15:76457548-76457570 TTTTGCTAGTGGTTGCTTGAAGG + Intronic
1132888420 16:2192776-2192798 TGGTGCTGGTAGTTGAGTGATGG - Intronic
1144325390 17:14174594-14174616 TTATGCTAATAGGTGTGTAGTGG - Intronic
1145407600 17:22618957-22618979 TTATTCTAGTAGGTGTGGAATGG - Intergenic
1146886968 17:36477759-36477781 TCATTCTAGTAGATGTGTGGTGG + Intergenic
1148725406 17:49786298-49786320 TAATGCTGGTATTTGTGTGACGG + Intronic
1151049752 17:70964112-70964134 TTATTCTAGTAGGTGTGTAGTGG + Intergenic
1154476781 18:14767999-14768021 GTATGCTAATAATTGAGTGATGG + Intronic
1156984270 18:43330461-43330483 TTATGCTTGTAGATGTGCGTGGG + Intergenic
1168434168 19:56304319-56304341 TTATGCTAGTGGTTCTGAAACGG + Intronic
925838822 2:7971387-7971409 TTATGTTCATATTTGTGTGAGGG - Intergenic
926499117 2:13630989-13631011 TTTTGCAAGAAGTTGTCTGACGG + Intergenic
927482583 2:23465908-23465930 TTCTGCTTGTGGGTGTGTGATGG + Intronic
932388618 2:71362980-71363002 TTATGCTAATAGGTGTATCAGGG - Intronic
933195050 2:79379746-79379768 TTATGTTAGTATTTCTGGGAAGG + Intronic
933658759 2:84909510-84909532 TAATGGTAGTGGTGGTGTGATGG - Intergenic
933658845 2:84909964-84909986 TAATGGTAGTGGTGGTGTGATGG - Intergenic
943346282 2:186741062-186741084 TTATGCTATAAGTTGTATTATGG + Intronic
944365853 2:198918764-198918786 GCATGCTCATAGTTGTGTGATGG - Intergenic
944624224 2:201554139-201554161 TTATACTAGTAGTCCTGTTAGGG - Intronic
946533834 2:220605678-220605700 TTATGCTTCCAGTTGTATGAGGG - Intergenic
1171319533 20:24229026-24229048 TCATTCTAGTAGGTGTGTAATGG - Intergenic
1173654164 20:44688146-44688168 TCATCCTAGTAGGTGTGAGATGG - Intergenic
1177083994 21:16678934-16678956 TTGTTATAGTAATTGTGTGATGG - Intergenic
1178443217 21:32615211-32615233 TTTTGTTTGTAGGTGTGTGATGG - Intergenic
1183718364 22:39547595-39547617 TTGTGCTTGTGTTTGTGTGAGGG + Intergenic
952801147 3:37293100-37293122 TTATTCTAGCAAATGTGTGAGGG + Intronic
954512897 3:51143211-51143233 CTATTCTAGTAGGTGTGTGGTGG + Intronic
955457335 3:59138329-59138351 TTATCATAGAAGTTCTGTGAAGG + Intergenic
957490225 3:80916464-80916486 TTATTTTGGTAGTTTTGTGAAGG - Intergenic
960536162 3:118816575-118816597 ATATGATAGTAGGTGTGTGTTGG - Intergenic
964212951 3:154248231-154248253 TTATGCTTCTAGCTCTGTGAGGG - Intronic
965028219 3:163329230-163329252 TTATGCTTGCAGGTGTTTGAAGG - Intergenic
966620587 3:181958997-181959019 ATATGCTAGTGGTTGTGTAGTGG + Intergenic
967560661 3:190915172-190915194 TTATTTTAGTAGGTGTGTAATGG + Intergenic
969997643 4:11329921-11329943 TTATGTTAGTAGTTGTAAGGTGG - Intergenic
972383093 4:38537040-38537062 TTCTGATACTGGTTGTGTGAAGG - Intergenic
974337860 4:60574610-60574632 TTATGCTACATATTGTGTGAGGG - Intergenic
977220184 4:94328857-94328879 TGATTCTAGTAGTTGTATGAGGG - Intronic
979335684 4:119458725-119458747 TTCTTCTAGTAGTTCTGAGATGG + Intergenic
982639507 4:157940430-157940452 TCATCCTAATGGTTGTGTGATGG - Intergenic
983311344 4:166065491-166065513 TATTGCTAGTAGTTGTGTGCTGG + Intronic
984088993 4:175346918-175346940 TTATGCTCGTAATGGTGGGAAGG + Intergenic
989079639 5:37604175-37604197 TTATTTTAGTAGATGTCTGATGG + Intronic
989264916 5:39462365-39462387 TTATCCTAGAAGTTGTGCAAAGG - Intergenic
989296390 5:39831942-39831964 TTATTCTAGTAGTGGTGTAGTGG + Intergenic
990827094 5:59912900-59912922 ATATGCTAGTAGGTGACTGAAGG + Intronic
992190949 5:74291256-74291278 GTATGCTAGCATTTGTGTGTTGG + Intergenic
993524644 5:88949062-88949084 TTTTCTTAGTAGTTGTGTGCTGG - Intergenic
994948050 5:106422300-106422322 TAATCCTAGTAGTTGTTTGGTGG + Intergenic
995002674 5:107153721-107153743 TGATGCTAGTATTTGGGGGAGGG + Intergenic
995225979 5:109701596-109701618 TTATTCTGGTAGCTGTGTGTAGG + Intronic
996393501 5:122988899-122988921 ATATGCTATTATTTGTGTTATGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999085735 5:148887684-148887706 TCATTCTGGTAGATGTGTGATGG - Intergenic
1001968283 5:175931124-175931146 TTATTTTAGTAGTTGTTTTAGGG - Intronic
1002964530 6:1950249-1950271 TTATACTAATATTAGTGTGAAGG - Intronic
1003367647 6:5491116-5491138 CGATTCTAGTAGTTATGTGATGG + Intronic
1004546595 6:16603900-16603922 TCATGCCAGTACCTGTGTGACGG - Intronic
1005905223 6:30256947-30256969 TTATTCTAGGTGATGTGTGATGG - Intergenic
1006477699 6:34268377-34268399 GTTTGCTAGTAGTTGGTTGAGGG - Intergenic
1007703353 6:43777033-43777055 TTATGGTAGTGGTTGTGGGGAGG + Intronic
1008210355 6:48715626-48715648 TTATGCTACTATTTCTGTTATGG + Intergenic
1009764408 6:68051083-68051105 CCATGCTAGTAGGTGTGTGATGG + Intergenic
1010831816 6:80540582-80540604 TTTTGCTTGGAGTGGTGTGATGG + Intergenic
1011669328 6:89667302-89667324 TAATGCTAGTATTTATGTTATGG - Intronic
1013768149 6:113597082-113597104 TTATGCTAACATCTGTGTGAGGG - Intergenic
1015004913 6:128268004-128268026 TGATGCTGGTAGTTTTATGATGG - Intronic
1018231353 6:161679127-161679149 TCAAGCTAGAAGTTGAGTGAAGG - Intronic
1021344367 7:19506837-19506859 TTATTCTAGAAGTAGTGTGCTGG + Intergenic
1023420757 7:39977121-39977143 TTATGCTAGTCCTTGAGAGATGG + Intronic
1024068407 7:45765032-45765054 TTCTTCTAGTAGTTCTGAGATGG - Intergenic
1025217823 7:57073888-57073910 TTCTTCTAGTAGTTCTGAGATGG - Intergenic
1025628734 7:63247526-63247548 TTCTTCTAGTAGTTCTGAGATGG - Intergenic
1025653529 7:63496574-63496596 TTCTTCTAGTAGTTCTGAGATGG + Intergenic
1028259565 7:88645325-88645347 TTATTCTAGTAGGTGTGTAGTGG - Intergenic
1028406801 7:90484246-90484268 TTATGCCAGTGGTTGGGGGATGG - Intronic
1028647904 7:93119174-93119196 TTATTCTGGTGGTTCTGTGAGGG + Intergenic
1029130092 7:98323196-98323218 TTATGCTCTTGGCTGTGTGAAGG - Intronic
1030576549 7:111293500-111293522 TTTTTATAGTAGTTTTGTGAAGG - Intronic
1038234922 8:25743494-25743516 TTTTGCTACTAGTAGAGTGATGG - Intergenic
1041013365 8:53566773-53566795 TTCTCCTAGATGTTGTGTGATGG + Intergenic
1041391687 8:57352758-57352780 TTTTGGAAGTAGATGTGTGATGG - Intergenic
1047079138 8:121440843-121440865 TTATTCTAGTAGGTGTGTAGTGG + Intergenic
1048905036 8:139079493-139079515 TATTGCTAGCAGCTGTGTGATGG + Intergenic
1051243597 9:15085681-15085703 TTCTGATAGTAGTTGTGAAATGG - Intergenic
1052802170 9:32978936-32978958 ATATGCTTTTAGTAGTGTGATGG - Intronic
1055517081 9:77044167-77044189 TTTAGCTAGGAGTGGTGTGATGG - Intergenic
1058562532 9:106245190-106245212 CTATTGTGGTAGTTGTGTGAAGG - Intergenic
1059436313 9:114278658-114278680 TGATGATAGTAGTGGTGTGGTGG + Intronic
1188058611 X:25572515-25572537 TTATTATAGTAGTTTTTTGATGG + Intergenic
1189726669 X:43974222-43974244 TTCTACTAGTTGTTGTGTAATGG - Intergenic
1192747386 X:73952725-73952747 TTCTGCCAGTTGTTGTGAGAAGG - Intergenic
1193413204 X:81189917-81189939 TTATTCTAATAGTTGTGTAGTGG + Intronic
1196898860 X:120363735-120363757 ATATGGTAGTGGGTGTGTGATGG - Intronic
1199923967 X:152442528-152442550 TTATGCTCTTAATTTTGTGAAGG - Intronic
1201475025 Y:14371807-14371829 TTTTGCTAGTAATTATTTGAGGG + Intergenic