ID: 909063882

View in Genome Browser
Species Human (GRCh38)
Location 1:70909494-70909516
Sequence GTCTCAGAAGGCCCCATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909063882 Original CRISPR GTCTCAGAAGGCCCCATAAA AGG Intronic
902156268 1:14489014-14489036 TTCTCTCAAGGCCCAATAAAGGG - Intergenic
902686644 1:18081709-18081731 GTCTCAGCAGGCCTCAGATAGGG + Intergenic
903657742 1:24959403-24959425 GCCTCAGAAGCCGCCATCAAAGG + Intronic
905251378 1:36650912-36650934 GTATCACAAGGCTCCTTAAAAGG + Intergenic
905651412 1:39659473-39659495 TTCTCATAGGGCCCCTTAAAGGG - Exonic
906031445 1:42723546-42723568 GTCTCAGCTGGCCTCCTAAAGGG - Intergenic
909063882 1:70909494-70909516 GTCTCAGAAGGCCCCATAAAAGG + Intronic
911194092 1:94976394-94976416 GTCTCAGATGGCCCCCAGAACGG + Exonic
915781225 1:158552681-158552703 GTCTCAGAAGTCTTCAAAAATGG + Intergenic
917717961 1:177757176-177757198 TTCTCAGAAGCAGCCATAAAGGG - Intergenic
919881079 1:201901018-201901040 GTCTGAGAATACTCCATAAAAGG - Intronic
921586917 1:216958000-216958022 GTTTCAGAAGGTCACATGAATGG + Intronic
1063104120 10:2977805-2977827 GTCTCAGCAGGCTCCCTAGAAGG + Intergenic
1063382926 10:5597458-5597480 GTCTCAGCAGGCCCCATTGGTGG - Intergenic
1065356577 10:24847387-24847409 GTCTCAGAAGGCCTGAAACATGG + Intergenic
1066051843 10:31643514-31643536 GTCCCAGAAGGCCTCATCACAGG + Intergenic
1069714313 10:70510691-70510713 GTCTCAGAAGGCTCCCTAGAGGG + Intronic
1072608859 10:97003718-97003740 GTCTCAGAGGGCCCCAAGACTGG + Intronic
1073655762 10:105414170-105414192 TTCTGAGAAAGCGCCATAAAAGG - Intergenic
1077681632 11:4247216-4247238 GTCTAAGAAGGCTCCTTAAGTGG - Intergenic
1077684098 11:4274678-4274700 GTCTAAAAAGGCTCCATAACTGG + Intergenic
1077685944 11:4292087-4292109 GTCTAAAAAGGCTCCATAACTGG - Intergenic
1077691093 11:4343247-4343269 GTCTAAAAAGGCTCCATAACTGG - Intergenic
1081720094 11:45282318-45282340 GTCTAAGAAGGCAGGATAAAGGG + Intronic
1085831378 11:79904916-79904938 GTCCCAGATGGCCACAAAAATGG + Intergenic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1086935547 11:92742255-92742277 CTCTGAGAAGGCATCATAAAGGG + Intronic
1087094971 11:94309206-94309228 CTCTGAGAAGGCCTCACAAAGGG + Intergenic
1092984817 12:13835554-13835576 CTCTCAGAAGGCCACGGAAATGG + Intronic
1097068011 12:56334793-56334815 GTTTCTAAAGGCCACATAAAGGG + Intronic
1099426137 12:82524990-82525012 GTCACAGAAGGGCCATTAAAGGG - Intergenic
1101129604 12:101675149-101675171 GTCTCAGAAGCCCCCATGGTAGG + Intronic
1101321942 12:103680415-103680437 GGCTCAGAAGGCAGCATAAAGGG + Intronic
1103111319 12:118281323-118281345 GTCATAGATGGCCCTATAAAAGG + Intronic
1104382202 12:128316835-128316857 GTCACAGATGGCCCCAGGAAAGG - Intronic
1105773405 13:23634292-23634314 TTCTCAGAAGGCCCCACCAAAGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107733823 13:43375110-43375132 GTCTCAGAAGCCACCAAAATAGG - Intronic
1110007102 13:70286783-70286805 GTCATAGAAGGCAGCATAAAGGG + Intergenic
1110674889 13:78230300-78230322 CTCTCAGAGGCCCCCACAAAAGG - Intergenic
1118011211 14:61612433-61612455 ATCCCAGAAGATCCCATAAATGG - Intronic
1118916611 14:70112745-70112767 GTCTCTGAAGGCCCCAGAAGAGG + Intronic
1121954463 14:98201268-98201290 GACTCAGAAGTCTCCATTAAAGG + Intergenic
1124125581 15:26935910-26935932 TTCTCAGATGGCCCCTGAAATGG + Intronic
1128513150 15:68326019-68326041 GTCTCAGGGGGCCCCTTAACAGG + Intronic
1128891839 15:71338540-71338562 GTCTCTAAAGACACCATAAAAGG - Intronic
1132060530 15:98688727-98688749 GACTCAAAAGGCCCCATAGATGG + Intronic
1143514304 17:7411691-7411713 CTCTCAGAAGGCCCCCTTCAGGG - Intronic
1150706662 17:67493248-67493270 GTCTCAGAAGAGCCCATTACAGG + Intronic
1151275134 17:73028524-73028546 GTCTTAGAAGGTCTCATACATGG - Intronic
1151345027 17:73496176-73496198 GTCACAGATGGCTCCATCAATGG - Intronic
1151578842 17:74966475-74966497 CACTCAGAAGGAGCCATAAAGGG - Intronic
1154318410 18:13324760-13324782 GTCACAGTAGGACCCAAAAAGGG + Intronic
1155952298 18:31926768-31926790 GTATCAGAAAGCCCAATAATTGG + Intronic
1156520348 18:37717044-37717066 GTCTCAAGAAGTCCCATAAAAGG - Intergenic
1163389955 19:17024772-17024794 GTCTCAGAAGGTCCCAGATTGGG + Intronic
1165324592 19:35106990-35107012 GTTACAGAAAGCCTCATAAAAGG + Intergenic
1165986835 19:39776919-39776941 GTCTCCCAAGGCCCCTTGAATGG + Intronic
928730190 2:34223124-34223146 GTTTTAGAAGTCCCCTTAAATGG - Intergenic
931768454 2:65477408-65477430 GCCTGAAAAGGCCCCATAACGGG - Intergenic
935146376 2:100398303-100398325 GGCTCTGAAGGCCTCATGAAGGG - Intronic
935391407 2:102557099-102557121 GTCTCAGTAGGCCTCATATTTGG + Intergenic
935962820 2:108444155-108444177 GTCTCAGAAGACCACCTAAATGG - Intergenic
939812016 2:146845208-146845230 GCCCCATAATGCCCCATAAAGGG - Intergenic
942055950 2:172182218-172182240 GTCTCAAAAATCCACATAAAGGG - Intergenic
942518449 2:176777938-176777960 GTCCCAGAAAGCCCGAGAAAAGG + Intergenic
942996181 2:182263302-182263324 GTCTCTGAAGGACCCACAAATGG - Intronic
943016526 2:182517098-182517120 GTCTCAGAAGACACCAGAAAAGG - Intronic
947716751 2:232343853-232343875 TCCTCAGAAAGCTCCATAAAGGG - Intronic
1169884130 20:10379112-10379134 TTATCAAAAGGTCCCATAAAAGG + Intergenic
1170021675 20:11843411-11843433 TTCTCAGAAGGACCAAGAAATGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172180018 20:32997183-32997205 GTCTCAGAGGACCTCAGAAAGGG - Intronic
1174124783 20:48296294-48296316 CTCTCAGAAGCCACAATAAAAGG + Intergenic
1174745575 20:53058504-53058526 TGCTCAGAAGGGCCCATACATGG - Intronic
1174819680 20:53715610-53715632 ATCTCAGAAGGCCCCATGCTTGG + Intergenic
1174989137 20:55489730-55489752 GTCTCAGAAGAGACCAAAAAAGG + Intergenic
1177386066 21:20410893-20410915 GTCTCAGAAAACTCCTTAAAAGG + Intergenic
1178813916 21:35909852-35909874 GTGTCAGAAGTCCCCAAATATGG - Intronic
1179642526 21:42756874-42756896 CTCTATGAAGGCCACATAAATGG + Intronic
1181627592 22:24132235-24132257 GTCTCAGGAAGCCCAAGAAAGGG - Intronic
1181635589 22:24172923-24172945 GGCTCTGAAGGCCCTATAATAGG + Intronic
950790666 3:15469225-15469247 GTCTCAGCAGGCTCAAGAAATGG + Intronic
950903354 3:16516133-16516155 GTCACAGATGGCCCCAGAACTGG + Intergenic
953262205 3:41350932-41350954 GTCTCAGAAGCATCAATAAAAGG + Intronic
953349450 3:42203728-42203750 GTCTAAGAAGGCTCCTTAGAGGG - Intronic
954926352 3:54238779-54238801 GTCTCAGTTGGCCCCATCATGGG - Intronic
955540601 3:59972263-59972285 GTCTCACAAGGCCCCATTCAGGG - Intronic
959945705 3:112123474-112123496 GTCTCAGAAGGGGCCATAAGTGG + Exonic
960364092 3:116749574-116749596 TTATCAGAATGCCACATAAATGG + Intronic
960639533 3:119812724-119812746 GTCTCTGCAGGCCCCATCGAGGG + Exonic
962673745 3:137736291-137736313 GCCTCAGCAAGCCCCATCAAAGG - Intergenic
966794443 3:183699803-183699825 ATCTCAGAAGCCCTGATAAAAGG - Intronic
966826720 3:183971054-183971076 GTCTCAGAGGGCCTCCTATAGGG - Intronic
976520244 4:86018111-86018133 GGCTCAGATGGCTCCATTAAGGG - Intronic
979084270 4:116386785-116386807 GTGTCAGAAGGGCCTTTAAAAGG + Intergenic
979601522 4:122591116-122591138 GTCTCAAATGGCCCCACATATGG - Intergenic
983343224 4:166493174-166493196 GTCTCCGGAGGCCCCTTTAAAGG + Intergenic
984047491 4:174818509-174818531 GTCTCAGGAGGCACCAGCAAAGG + Intronic
985888807 5:2700094-2700116 CTCTCAGAAGGCACCAGAATGGG + Intergenic
986360623 5:6974882-6974904 GTCACAAAAGGCCCCATGAGAGG - Intergenic
991111864 5:62909485-62909507 GTCTGTGAAGGCTCCTTAAAGGG - Intergenic
998816670 5:146021539-146021561 CACTCAGTAGGCCCTATAAAAGG - Intronic
1000217782 5:159180221-159180243 GTTTCAGAAGAACCCATAAAAGG - Intronic
1001665066 5:173425877-173425899 GTCTCAGAATGCTGAATAAAAGG + Intergenic
1003335942 6:5172316-5172338 TTCTCAGAAGGCCCAAAAAAAGG + Intronic
1011253340 6:85396146-85396168 GTCTCAGTAGACACTATAAAAGG - Intergenic
1014421139 6:121246497-121246519 GTCACAGTAGGCCCCAGCAATGG + Intronic
1014908779 6:127063682-127063704 ATCTCAGAATGCCCCAGCAAAGG - Intergenic
1018010423 6:159665077-159665099 TTCTCCAAAGGCCCCATAAATGG - Intergenic
1019604048 7:1899642-1899664 GAGTCTGAAGGCCCCAGAAAGGG + Intronic
1019691673 7:2418316-2418338 GTGTCAGATGCCCTCATAAATGG - Intronic
1019747035 7:2706520-2706542 GTCTCAGAAGGCTCCGTGGAGGG + Intronic
1020097024 7:5374901-5374923 GTCTCAAAAGGCCCCAAAGAGGG + Intronic
1021550622 7:21867612-21867634 GTCTCAGTAGCCCCCCAAAATGG + Intronic
1022592554 7:31679691-31679713 TGTTCAGAAGCCCCCATAAACGG + Intergenic
1023086867 7:36579554-36579576 CTCTCACAAGGTCCCATAATAGG + Intronic
1028106327 7:86883152-86883174 GTCTTACAATGTCCCATAAATGG + Intronic
1028616183 7:92769877-92769899 TTCTCATAAAGCTCCATAAATGG + Intronic
1031902844 7:127429237-127429259 GGCTCAGCAGGCCCCATACTTGG + Intronic
1038359768 8:26865151-26865173 CCCTCAGAAGGCCACATGAAGGG + Exonic
1038886414 8:31667636-31667658 GCTGCAGAAGGCCCCAGAAAGGG + Intronic
1038925959 8:32139691-32139713 GTCTCAGAAGCCACCACTAAAGG + Intronic
1040341266 8:46442333-46442355 CTCCCAGAAGGCCCCAACAACGG - Intergenic
1044023172 8:87132513-87132535 ATCTCAGCAAGCCCCATACAGGG - Intronic
1047743207 8:127823891-127823913 GCCTCAGATAGCCCCTTAAAGGG - Intergenic
1048101095 8:131352212-131352234 ATAAAAGAAGGCCCCATAAATGG - Intergenic
1052654243 9:31335061-31335083 GCCTCAGGAGGGCCCAGAAAAGG + Intergenic
1053613799 9:39743197-39743219 GGTTCAGAAGGCACCATAATTGG + Intergenic
1053871840 9:42501154-42501176 GGTTCAGAAGGCACCATAATTGG + Intergenic
1054239716 9:62599200-62599222 GGTTCAGAAGGCACCATAATTGG - Intergenic
1054553850 9:66633727-66633749 GGTTCAGAAGGCACCATAATTGG - Intergenic
1056726530 9:89123838-89123860 TTCCAAGAAGGGCCCATAAATGG + Intronic
1057566508 9:96169838-96169860 ATCTCAGAAGGCAAAATAAAGGG - Intergenic
1058995871 9:110298290-110298312 ATCTCAGTAGGCCCCCTAAAAGG - Intergenic
1191119258 X:56886483-56886505 GTCTCAGAAGCCCTCCTAAAGGG - Intergenic
1193469884 X:81887443-81887465 GCCTCAGCAAGCCCCACAAAAGG - Intergenic
1194364285 X:92995431-92995453 GGCTCAGGAGGCCTCACAAATGG - Intergenic
1194522885 X:94940151-94940173 GTCTTAAAAGGCCCCAGATATGG - Intergenic
1195152486 X:102086067-102086089 GTCTAAGAAGCCTCCATAAAGGG + Intergenic
1195152539 X:102086640-102086662 GTCTAAAAAGCCTCCATAAAGGG - Intergenic
1198680901 X:139181237-139181259 ATCTCAGAAGACCTCACAAAAGG + Intronic
1199620844 X:149699328-149699350 GGCTTAGAAAGTCCCATAAAAGG - Intronic
1200238166 X:154479084-154479106 GTCTCAGAAGGCCCCCGGCAGGG - Exonic
1200672518 Y:6111696-6111718 GGCTCAGGAGGCCTCACAAATGG - Intergenic
1201343748 Y:12960324-12960346 GTGACAGAAGGCACCATATATGG - Intergenic