ID: 909063937

View in Genome Browser
Species Human (GRCh38)
Location 1:70910264-70910286
Sequence TGTGGCTTTAGGCAGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909063937_909063943 -3 Left 909063937 1:70910264-70910286 CCCAGTTTCTGCCTAAAGCCACA No data
Right 909063943 1:70910284-70910306 ACAAGGCTGCCTGACAGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 189
909063937_909063941 -6 Left 909063937 1:70910264-70910286 CCCAGTTTCTGCCTAAAGCCACA No data
Right 909063941 1:70910281-70910303 GCCACAAGGCTGCCTGACAGTGG 0: 1
1: 0
2: 4
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909063937 Original CRISPR TGTGGCTTTAGGCAGAAACT GGG (reversed) Intronic
No off target data available for this crispr