ID: 909067770

View in Genome Browser
Species Human (GRCh38)
Location 1:70956638-70956660
Sequence TGGTGCCAACAACTGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909067766_909067770 9 Left 909067766 1:70956606-70956628 CCTTTAGAGGCTTCTAAAGCACC 0: 1
1: 0
2: 0
3: 18
4: 116
Right 909067770 1:70956638-70956660 TGGTGCCAACAACTGGACTATGG 0: 1
1: 0
2: 1
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909067770 Original CRISPR TGGTGCCAACAACTGGACTA TGG Intronic
901668218 1:10838465-10838487 TGGTGCCGCCAACAGGAGTAAGG - Intergenic
902709451 1:18228530-18228552 TGGTGCCAACACCTGGGCCCTGG - Intronic
909067770 1:70956638-70956660 TGGTGCCAACAACTGGACTATGG + Intronic
909982390 1:82117954-82117976 TGGAGCCAAAACCTTGACTAAGG - Intergenic
910133018 1:83931845-83931867 TGGCGCCATCAAGTGGAATAAGG - Intronic
910541754 1:88367106-88367128 TGGTGCAAACAACTGTAAAAGGG - Intergenic
910594538 1:88965397-88965419 TTATGCCAACCAATGGACTAGGG + Intronic
912172351 1:107116222-107116244 TGGTGCCAACCACTGGGTAAAGG + Intergenic
913016012 1:114736034-114736056 TGGTACCATAAACTGGGCTAAGG - Intronic
916887953 1:169088355-169088377 TGGTGCCAGCCACTGAGCTATGG - Intergenic
922288458 1:224190117-224190139 TGCTGCCAACATGTAGACTAAGG - Exonic
1068254902 10:54497009-54497031 TGCTGCCAACAAAAGCACTATGG - Intronic
1069486099 10:68824804-68824826 TTGTGCCTAGAACTGTACTAAGG - Intergenic
1073515910 10:104075361-104075383 TGGTGCCAACAACTGAAACAGGG - Intronic
1074263195 10:111874597-111874619 TGGTGCCAACAGTAGGACTTTGG - Intergenic
1081097006 11:38949205-38949227 TGGTTCAAACATCTGGCCTAGGG + Intergenic
1085955563 11:81389479-81389501 TGGCCCCAACAACAGGAGTAAGG + Intergenic
1088735413 11:112724371-112724393 TGGAGCCAACAGCTGGACTGTGG - Intergenic
1089065855 11:115661263-115661285 TGGTTCCAACTACTTGACTGAGG + Intergenic
1089500187 11:118927443-118927465 TGGTGCCAACAGCTGGGCACTGG + Intronic
1090234748 11:125139222-125139244 TGGGGCCAAGAACTGGAGTGGGG - Intergenic
1091322227 11:134659865-134659887 TGCTGCCCACATCTGGACTGTGG + Intergenic
1091525591 12:1297049-1297071 TGTTTCCAGCAACTGGACTATGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093244853 12:16723543-16723565 TGGTGACAACAACTGAGATAGGG + Intergenic
1096385714 12:51193996-51194018 TGGTGTCAAGAACTGGACTGTGG - Intronic
1097712380 12:62931254-62931276 TGGTGATAAGAACTGTACTAAGG - Intronic
1100631339 12:96392551-96392573 TGGTGTGACTAACTGGACTAAGG + Intronic
1101422560 12:104561702-104561724 TGGTGCCAGCCACTGCGCTAAGG + Intronic
1101708043 12:107239228-107239250 AAATGCCAACAACTGTACTAAGG + Intergenic
1102212062 12:111134539-111134561 TGGTGCCAAAATCTGTATTAGGG + Intronic
1102412697 12:112733961-112733983 AAGTGCCAACCACTGTACTAAGG + Intronic
1103887521 12:124214086-124214108 TGGAGCCAACAACGGTACTAGGG - Intronic
1104750970 12:131238311-131238333 AGGTGCCAAAAACTGTATTAAGG + Intergenic
1105581716 13:21704201-21704223 TGGTGCCAACACTTGCACTGTGG + Exonic
1106614151 13:31310835-31310857 GGGTGCCAGCATCTGGACAAGGG - Intronic
1107684531 13:42883796-42883818 TGGTGCCAATCACTGGTGTAAGG + Intergenic
1108169469 13:47726209-47726231 TGTTTCTAACACCTGGACTAGGG + Intergenic
1111794022 13:92894780-92894802 TGTTACCAACATCTGGGCTAGGG + Intergenic
1113508027 13:110830639-110830661 TTGTGCAAACACCTGGTCTATGG + Intergenic
1117377010 14:55126225-55126247 TGGTGCCAACAACTGGAATCTGG - Intronic
1123519918 15:21062509-21062531 TGGTGCTAACATTTGGACTGTGG + Intergenic
1123579954 15:21705956-21705978 TGGTGCTAACATTTGGACTGTGG - Intergenic
1123616602 15:22148578-22148600 TGGTGCTAACATTTGGACTGTGG - Intergenic
1126782867 15:52153312-52153334 GGTTGCCGACAGCTGGACTAAGG - Intronic
1127115157 15:55719169-55719191 TGGTACCAAAAACTGGAGTTGGG + Intronic
1128599664 15:68985287-68985309 AGGTGCCAACCAGTGGACTTTGG + Intronic
1130652206 15:85768532-85768554 TGGGGCCAACAAGTGGATGATGG - Exonic
1131217803 15:90554158-90554180 TTGTGCCAACCACTGTTCTAAGG - Intronic
1202988824 15_KI270727v1_random:440201-440223 TGGTGCTAACATTTGGACTGTGG - Intergenic
1132542321 16:516286-516308 TGGTGAGGACAACTGGATTATGG + Intronic
1134513116 16:14864679-14864701 TGATGCCAAGAACTGTACAAAGG - Exonic
1134700752 16:16263168-16263190 TGATGCCAAGAACTGTACAAAGG - Exonic
1134971072 16:18531491-18531513 TGATGCCAAGAACTGTACAAAGG + Exonic
1136531444 16:30872347-30872369 TGGTGCCCACAGGTGGAATAGGG + Intronic
1136932400 16:34431321-34431343 TGTTGTCAAAAAGTGGACTAAGG - Intergenic
1136972172 16:34980493-34980515 TGTTGTCAAAAAGTGGACTAAGG + Intergenic
1137546085 16:49404682-49404704 TCCTGCCAACATCTGGACTTTGG - Intergenic
1149978396 17:61289069-61289091 TTGTTCCAACAAGTGGACTAAGG - Intronic
1150648865 17:66997019-66997041 TGGGGCCAGCAACAGGACTCAGG + Intronic
1157871400 18:51233169-51233191 TGGTGCCAAAATCTGTATTAGGG + Intergenic
1158208824 18:55023790-55023812 TGGTGGCCACAACTGGAGGACGG + Intergenic
1158476934 18:57788632-57788654 TGGTGCCAGGAACTGGGTTAGGG - Intronic
1159587238 18:70292464-70292486 TGGTCCCAACAACTGGCGGAGGG - Intronic
1163209351 19:15829203-15829225 TGGTGCCAAAATCTGGGCCAGGG + Intergenic
925129386 2:1483631-1483653 TGGTGCCAAGCACTGTGCTATGG - Intronic
931692399 2:64846363-64846385 TGCTCCCTACAAATGGACTAGGG - Intergenic
931987823 2:67758350-67758372 TGGTGCCAAGCTCTGGAATATGG - Intergenic
932686619 2:73876113-73876135 CGGTGGCAACTACTGGACTTAGG - Intergenic
934028801 2:88023030-88023052 TGCTGCTAACAACTGAACCATGG + Intergenic
937519727 2:122697630-122697652 TCCTGCCAACACCTGGACTTTGG - Intergenic
939702056 2:145404819-145404841 TGGTGCTACCCACGGGACTAAGG + Intergenic
947175334 2:227361048-227361070 TGTTGCCAACAACTAGAACACGG - Intergenic
1169056199 20:2623633-2623655 TGGTGCCAAGAGGTGGAATACGG - Intronic
1170654641 20:18274953-18274975 TGGTTCCAGCAACTGGAAAATGG - Intergenic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1172599801 20:36175862-36175884 TGGTGCCACCATCTGTACAAAGG - Intronic
1173467005 20:43291155-43291177 TGCTGCCAGCAGCTGGAATAGGG - Intergenic
1175525193 20:59628937-59628959 TGGTGCCAACCAGTGAACCATGG - Intronic
1178431691 21:32523330-32523352 TGATTCCACCAAATGGACTAGGG + Intergenic
1182339662 22:29609186-29609208 TGGTGCCAAATACTGAACTGAGG - Intronic
952668881 3:35941904-35941926 TGTAGACAACATCTGGACTAGGG + Intergenic
953266352 3:41392809-41392831 TGGTGCCAGTAATTGGATTAAGG - Intronic
955952441 3:64255917-64255939 TGGTGGCAGCAGCTGAACTATGG + Intronic
957566269 3:81888230-81888252 ATGTGCCAAACACTGGACTAAGG - Intergenic
959932258 3:111997769-111997791 TTATGCCAACTACTGGACTGAGG - Intergenic
960555417 3:119023388-119023410 TTTTGCCTACAAATGGACTATGG + Intronic
962175647 3:133151288-133151310 TGGTGCCATAAACTGGGTTAGGG - Intronic
971282315 4:25250962-25250984 AGGTGCCAGCAACTGCAATATGG + Intronic
972107325 4:35505890-35505912 ACATGCCAACAACTGCACTAAGG + Intergenic
973547085 4:51992762-51992784 TGATGCCAACAGGTGGACTAGGG + Intergenic
976658132 4:87510896-87510918 TGGTGCCCACACCTGGACGCTGG + Intronic
978401981 4:108340938-108340960 AGCTGCCAACAAATGGGCTAGGG + Intergenic
979297301 4:119048396-119048418 TGGTGCCAAGTACTGTTCTAGGG + Intronic
983273227 4:165587823-165587845 TGGTGCCAAACACTAGGCTAAGG - Intergenic
984567001 4:181343099-181343121 TGGTGCTCACAACTGCACGAAGG + Intergenic
986005241 5:3662000-3662022 TGAGGCCAACCACTGGTCTAAGG - Intergenic
986427168 5:7645149-7645171 AGATGCCCACAACTTGACTAAGG - Intronic
987312468 5:16694000-16694022 TGCTGGCAACAGCTGGAGTAAGG + Intronic
988021194 5:25624778-25624800 TGATGCCAATAACTAGACAATGG + Intergenic
994577521 5:101597567-101597589 TTAGGCCAACAACTGTACTAAGG + Intergenic
997698731 5:135881362-135881384 TGGTGCCAGAACCTGGACAAAGG + Intronic
997988169 5:138521306-138521328 AGTTGCCAGCAACTGGAGTAAGG + Intronic
1002009723 5:176268678-176268700 TGAAGCAAACAACTGAACTAAGG + Intronic
1003141084 6:3471871-3471893 TGGTTCCAACAACTGCCTTAAGG + Intergenic
1008501173 6:52184826-52184848 TGATGCCAAAACCAGGACTACGG + Intergenic
1012360400 6:98370298-98370320 TAGTGCCAAGTACTGGACTAGGG + Intergenic
1013094031 6:106927984-106928006 TGGTGCTGACAACAGGCCTATGG + Intergenic
1015144312 6:129968453-129968475 AGGTGCCAAGGGCTGGACTAAGG - Intergenic
1016780999 6:147958280-147958302 AGGTGACAAAAACTGGATTATGG - Intergenic
1020375296 7:7478555-7478577 TGGTGCCATCAACTGCCCAAGGG - Intronic
1020931208 7:14397398-14397420 TATTTCTAACAACTGGACTATGG - Intronic
1025147425 7:56516725-56516747 TGTTGCCAACAACTTGCCTGAGG - Intergenic
1026318955 7:69252403-69252425 TGTTGCCAACAACTTGCCTGAGG + Intergenic
1027454225 7:78367603-78367625 TTTTGCCAACATATGGACTAAGG + Intronic
1029277894 7:99418434-99418456 TGGGGCCAACAACTGTGCTGAGG - Exonic
1032934167 7:136710139-136710161 TGGTTGTAACAACTGGACTGGGG - Intergenic
1035948569 8:3993128-3993150 TGGTGCCAATAATTACACTATGG + Intronic
1036084668 8:5600314-5600336 TTGTGCCAACAAGAGGCCTAAGG - Intergenic
1036114080 8:5939859-5939881 TTGTACCAAACACTGGACTAGGG + Intergenic
1044238561 8:89860707-89860729 TGGTAGCAACAACTGGATCACGG + Intergenic
1048612591 8:136040042-136040064 GAGAGCCACCAACTGGACTAAGG - Intergenic
1049740130 8:144235957-144235979 TGATTCCAACATCTGGACTATGG - Intronic
1055894246 9:81157382-81157404 TGGTGCCACCCACTGGGCAAAGG - Intergenic
1059732941 9:117074692-117074714 GGGTGCCAAGAACTATACTAAGG + Intronic
1187096876 X:16158045-16158067 GGGTGCGAACAACTGACCTAAGG - Intergenic
1189004810 X:36984611-36984633 TGGAGCCAACTACTGTTCTAGGG - Intergenic
1189044225 X:37573333-37573355 TGGAGCCAACTACTGTTCTAGGG + Intronic
1189247418 X:39574389-39574411 TGGGGCCAAAAACTGGATTCTGG + Intergenic
1195714511 X:107805624-107805646 TGGTGCCACTAACTGGGATAGGG - Intergenic
1197714339 X:129695550-129695572 TTGTGCCAGCGACTGGGCTAAGG - Intergenic
1201383601 Y:13413653-13413675 GGGTGCTGGCAACTGGACTACGG - Intronic
1202338569 Y:23835877-23835899 TGGTGGCGACAACTGGAAGATGG + Intergenic
1202532197 Y:25834195-25834217 TGGTGGCGACAACTGGAAGATGG - Intergenic