ID: 909075502

View in Genome Browser
Species Human (GRCh38)
Location 1:71047107-71047129
Sequence CAGCGCCCGCTCGACGGCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909075497_909075502 -2 Left 909075497 1:71047086-71047108 CCAGTGCGGCGCCCTGATGGCCA 0: 1
1: 0
2: 1
3: 3
4: 75
Right 909075502 1:71047107-71047129 CAGCGCCCGCTCGACGGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909075502 Original CRISPR CAGCGCCCGCTCGACGGCCA TGG Exonic
900092054 1:924899-924921 CAGCGGCCGCGAGACGGCCAAGG + Intronic
901050785 1:6424954-6424976 CAGCGCCTGCTCCAGGGCCATGG - Exonic
902707033 1:18212707-18212729 CAGTGCCCTCTCCAGGGCCAGGG - Intronic
909075502 1:71047107-71047129 CAGCGCCCGCTCGACGGCCATGG + Exonic
919784531 1:201250862-201250884 CAGCGCCCTCTCCACCTCCAAGG - Intergenic
924619572 1:245649028-245649050 CAGCGCTGGCTGGATGGCCAGGG - Intronic
1069849532 10:71396426-71396448 GAGCGCCCGCTCGCCCGCCCGGG + Intergenic
1073088536 10:100912714-100912736 CCGCCCCCGCGCGCCGGCCAAGG + Intronic
1081691274 11:45080239-45080261 CAGCGCCAGCTCCAGGGCCCAGG + Intergenic
1082076493 11:47980046-47980068 CAGCCCCCGAGCGCCGGCCAGGG - Intergenic
1085284654 11:75351788-75351810 CAGCGCCCGGGCCGCGGCCAGGG + Intergenic
1089757426 11:120696789-120696811 GAGCGCCCCCTAGAGGGCCAGGG + Intronic
1104568220 12:129903726-129903748 CAGCGCCCGCTAGCCAGCCCGGG - Intergenic
1104787824 12:131461238-131461260 CAGTGCCCACTCCACTGCCAGGG - Intergenic
1106340240 13:28820238-28820260 CCGCCCCCGCTCGAGGGCCGGGG - Intergenic
1113874170 13:113584441-113584463 CGGCGTGCGCTCGGCGGCCAAGG - Intergenic
1118849163 14:69571603-69571625 GAGCGCCCGCTCCACAGCCCGGG - Exonic
1119296532 14:73537723-73537745 CACCTCCAGCTCCACGGCCAAGG - Exonic
1119300776 14:73569728-73569750 CACCTCCAGCTCCACGGCCAAGG - Exonic
1121715130 14:96068407-96068429 GAGTGCCCGCTGGACGGGCACGG - Intronic
1122658638 14:103279519-103279541 CAGCACCCGCGGGACGGCCCCGG - Intergenic
1123630624 15:22257844-22257866 CAGCGCCCGTTCCGCGGCCGCGG + Intergenic
1128028645 15:64460772-64460794 CAGCGGCGGCTCTACGGCCCGGG + Intronic
1128743641 15:70099158-70099180 CACCGCCCGGTGGACGGCCAAGG + Intergenic
1132527914 16:426506-426528 CAGCGCCAGCTCGCCCGCCGTGG - Exonic
1132598946 16:765431-765453 CAGCGTCCCCTCCACAGCCAGGG + Intronic
1133315872 16:4883708-4883730 CTGCTCCCGCTTGACGGCCACGG + Exonic
1136416350 16:30106486-30106508 CAGTGCCCACTCAACGGGCAGGG - Intronic
1139511635 16:67431261-67431283 CAGGCGCCGCCCGACGGCCAAGG - Exonic
1141932813 16:87217131-87217153 CAGCGCCCGCTTCCCTGCCAGGG + Intronic
1142261161 16:89043025-89043047 CAGGGGCCGCCCGACTGCCAGGG + Intergenic
1147580890 17:41626494-41626516 CAGCCCCACCTCGAGGGCCACGG - Intergenic
1147686393 17:42288952-42288974 CGGCTCCCACTCGACGGCTAGGG - Intronic
1147989758 17:44325417-44325439 CAGCGCCTTCTGGACGGCGAGGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1158478795 18:57803097-57803119 CAGCGCTAGCGCGGCGGCCAGGG - Intronic
1163311755 19:16519173-16519195 CATCGCCCGCATGAAGGCCAGGG - Exonic
1166660529 19:44644107-44644129 CAGCGGCCACGCGGCGGCCATGG - Exonic
1166871244 19:45872385-45872407 CGGCGCCTGCTGGATGGCCATGG - Exonic
927969797 2:27298393-27298415 CAGCGCACGGTGGACGGCCATGG - Intronic
928087130 2:28352886-28352908 CAGCTCCCGCTGACCGGCCAGGG - Intergenic
932700230 2:73986423-73986445 CAGGTCCGGCTGGACGGCCAGGG - Exonic
1176145433 20:63563341-63563363 CAGGGCCGTCTCCACGGCCAGGG + Exonic
1183910354 22:41074608-41074630 CATCTCCCGCTCGAAGTCCAGGG + Intergenic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
998263283 5:140647489-140647511 CAGCGCTCGCCCGGCAGCCAGGG - Exonic
1001009652 5:168086206-168086228 CAGCCCCCGCTCCACGGTCTAGG + Intronic
1002133845 5:177096551-177096573 CAGCGCCCTCCCGACGACCGGGG - Intronic
1002471077 5:179436473-179436495 CAGCCCCTGCTCGGCAGCCATGG + Intergenic
1002633435 5:180595625-180595647 CAGCGCCCTCTCGTCAGCCTGGG + Intergenic
1004194184 6:13488611-13488633 CAGTGCCCCCTCGAGGGCCTGGG - Intergenic
1006090836 6:31627856-31627878 CCGGGCCCGCTCCACTGCCAGGG - Exonic
1019663856 7:2241796-2241818 CAGGGCCCACTCGACAGCCCAGG + Intronic
1030261035 7:107564118-107564140 AAGCGCCGGCCCGACGGCCTTGG - Exonic
1034455655 7:151168270-151168292 CAACGTCCGCTCCACGGGCAGGG - Intronic
1186669841 X:11757868-11757890 GAGCGCCCGCTCTCCGGCCCGGG - Intergenic
1188451105 X:30308860-30308882 CAGCGCCCGAGGCACGGCCAGGG - Exonic