ID: 909085691

View in Genome Browser
Species Human (GRCh38)
Location 1:71167702-71167724
Sequence GAAGCTGCACAGATCCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909085690_909085691 17 Left 909085690 1:71167662-71167684 CCTATTGTAATATGTATCTGTGC No data
Right 909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909085691 Original CRISPR GAAGCTGCACAGATCCTGCT TGG Intergenic
No off target data available for this crispr