ID: 909089906

View in Genome Browser
Species Human (GRCh38)
Location 1:71212578-71212600
Sequence ACTTTCCAGGCTTTAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909089906_909089913 1 Left 909089906 1:71212578-71212600 CCTAGTTCTAAAGCCTGGAAAGT No data
Right 909089913 1:71212602-71212624 CATGATCAAGGTTCTGGGCAGGG No data
909089906_909089910 -4 Left 909089906 1:71212578-71212600 CCTAGTTCTAAAGCCTGGAAAGT No data
Right 909089910 1:71212597-71212619 AAGTCCATGATCAAGGTTCTGGG No data
909089906_909089909 -5 Left 909089906 1:71212578-71212600 CCTAGTTCTAAAGCCTGGAAAGT No data
Right 909089909 1:71212596-71212618 AAAGTCCATGATCAAGGTTCTGG No data
909089906_909089912 0 Left 909089906 1:71212578-71212600 CCTAGTTCTAAAGCCTGGAAAGT No data
Right 909089912 1:71212601-71212623 CCATGATCAAGGTTCTGGGCAGG No data
909089906_909089915 19 Left 909089906 1:71212578-71212600 CCTAGTTCTAAAGCCTGGAAAGT No data
Right 909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG No data
909089906_909089914 13 Left 909089906 1:71212578-71212600 CCTAGTTCTAAAGCCTGGAAAGT No data
Right 909089914 1:71212614-71212636 TCTGGGCAGGGTTTGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909089906 Original CRISPR ACTTTCCAGGCTTTAGAACT AGG (reversed) Intergenic
No off target data available for this crispr