ID: 909089908

View in Genome Browser
Species Human (GRCh38)
Location 1:71212591-71212613
Sequence ACCTTGATCATGGACTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909089908_909089915 6 Left 909089908 1:71212591-71212613 CCTGGAAAGTCCATGATCAAGGT No data
Right 909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG No data
909089908_909089914 0 Left 909089908 1:71212591-71212613 CCTGGAAAGTCCATGATCAAGGT No data
Right 909089914 1:71212614-71212636 TCTGGGCAGGGTTTGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909089908 Original CRISPR ACCTTGATCATGGACTTTCC AGG (reversed) Intergenic
No off target data available for this crispr