ID: 909089911

View in Genome Browser
Species Human (GRCh38)
Location 1:71212601-71212623
Sequence CCTGCCCAGAACCTTGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909089911_909089915 -4 Left 909089911 1:71212601-71212623 CCATGATCAAGGTTCTGGGCAGG No data
Right 909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG No data
909089911_909089914 -10 Left 909089911 1:71212601-71212623 CCATGATCAAGGTTCTGGGCAGG No data
Right 909089914 1:71212614-71212636 TCTGGGCAGGGTTTGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909089911 Original CRISPR CCTGCCCAGAACCTTGATCA TGG (reversed) Intergenic
No off target data available for this crispr