ID: 909089915

View in Genome Browser
Species Human (GRCh38)
Location 1:71212620-71212642
Sequence CAGGGTTTGAACTCTGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909089906_909089915 19 Left 909089906 1:71212578-71212600 CCTAGTTCTAAAGCCTGGAAAGT No data
Right 909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG No data
909089908_909089915 6 Left 909089908 1:71212591-71212613 CCTGGAAAGTCCATGATCAAGGT No data
Right 909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG No data
909089911_909089915 -4 Left 909089911 1:71212601-71212623 CCATGATCAAGGTTCTGGGCAGG No data
Right 909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909089915 Original CRISPR CAGGGTTTGAACTCTGGTGA AGG Intergenic
No off target data available for this crispr