ID: 909095989

View in Genome Browser
Species Human (GRCh38)
Location 1:71290051-71290073
Sequence CTTTATCAGCAGAATGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909095988_909095989 -7 Left 909095988 1:71290035-71290057 CCAGTCTTAAGTATGTCTTTATC No data
Right 909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG No data
909095986_909095989 14 Left 909095986 1:71290014-71290036 CCTCTTTCTTTTGTAAATTGCCC 0: 1592
1: 1792
2: 1635
3: 5247
4: 9684
Right 909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG No data
909095987_909095989 -6 Left 909095987 1:71290034-71290056 CCCAGTCTTAAGTATGTCTTTAT No data
Right 909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG No data
909095985_909095989 22 Left 909095985 1:71290006-71290028 CCATTAAACCTCTTTCTTTTGTA 0: 772
1: 1406
2: 1813
3: 1598
4: 1768
Right 909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909095989 Original CRISPR CTTTATCAGCAGAATGAAAG TGG Intergenic
No off target data available for this crispr