ID: 909097461

View in Genome Browser
Species Human (GRCh38)
Location 1:71305570-71305592
Sequence CAAAATGCTGGGATGGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909097453_909097461 24 Left 909097453 1:71305523-71305545 CCATGTTGGTCAGGCTGGTCTTG 0: 10734
1: 66234
2: 131886
3: 161016
4: 155050
Right 909097461 1:71305570-71305592 CAAAATGCTGGGATGGATATTGG No data
909097455_909097461 -8 Left 909097455 1:71305555-71305577 CCTCAGCTGATCTCCCAAAATGC No data
Right 909097461 1:71305570-71305592 CAAAATGCTGGGATGGATATTGG No data
909097454_909097461 -3 Left 909097454 1:71305550-71305572 CCTGACCTCAGCTGATCTCCCAA No data
Right 909097461 1:71305570-71305592 CAAAATGCTGGGATGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909097461 Original CRISPR CAAAATGCTGGGATGGATAT TGG Intergenic
No off target data available for this crispr