ID: 909100399

View in Genome Browser
Species Human (GRCh38)
Location 1:71341789-71341811
Sequence ACTTAGCCCTGGAGTGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909100395_909100399 19 Left 909100395 1:71341747-71341769 CCTTGTGCAGGTGAGACAAACTG No data
Right 909100399 1:71341789-71341811 ACTTAGCCCTGGAGTGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909100399 Original CRISPR ACTTAGCCCTGGAGTGTAAC AGG Intergenic
No off target data available for this crispr