ID: 909104497

View in Genome Browser
Species Human (GRCh38)
Location 1:71391887-71391909
Sequence GCCAGAGCAGCTGGGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909104497_909104503 -9 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104503 1:71391901-71391923 TGCTCTGGCCATGGCTGAAAGGG No data
909104497_909104509 25 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data
909104497_909104505 9 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104505 1:71391919-71391941 AAGGGACCAACATTGAGCTCAGG No data
909104497_909104502 -10 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104502 1:71391900-71391922 CTGCTCTGGCCATGGCTGAAAGG No data
909104497_909104507 15 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104507 1:71391925-71391947 CCAACATTGAGCTCAGGCCGTGG No data
909104497_909104508 24 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909104497 Original CRISPR GCCAGAGCAGCTGGGACACA GGG (reversed) Intergenic