ID: 909104498

View in Genome Browser
Species Human (GRCh38)
Location 1:71391888-71391910
Sequence GGCCAGAGCAGCTGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909104498_909104503 -10 Left 909104498 1:71391888-71391910 CCTGTGTCCCAGCTGCTCTGGCC No data
Right 909104503 1:71391901-71391923 TGCTCTGGCCATGGCTGAAAGGG No data
909104498_909104505 8 Left 909104498 1:71391888-71391910 CCTGTGTCCCAGCTGCTCTGGCC No data
Right 909104505 1:71391919-71391941 AAGGGACCAACATTGAGCTCAGG No data
909104498_909104507 14 Left 909104498 1:71391888-71391910 CCTGTGTCCCAGCTGCTCTGGCC No data
Right 909104507 1:71391925-71391947 CCAACATTGAGCTCAGGCCGTGG No data
909104498_909104509 24 Left 909104498 1:71391888-71391910 CCTGTGTCCCAGCTGCTCTGGCC No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data
909104498_909104508 23 Left 909104498 1:71391888-71391910 CCTGTGTCCCAGCTGCTCTGGCC No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909104498 Original CRISPR GGCCAGAGCAGCTGGGACAC AGG (reversed) Intergenic