ID: 909104501

View in Genome Browser
Species Human (GRCh38)
Location 1:71391896-71391918
Sequence TCAGCCATGGCCAGAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909104501_909104507 6 Left 909104501 1:71391896-71391918 CCAGCTGCTCTGGCCATGGCTGA No data
Right 909104507 1:71391925-71391947 CCAACATTGAGCTCAGGCCGTGG No data
909104501_909104508 15 Left 909104501 1:71391896-71391918 CCAGCTGCTCTGGCCATGGCTGA No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data
909104501_909104509 16 Left 909104501 1:71391896-71391918 CCAGCTGCTCTGGCCATGGCTGA No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data
909104501_909104505 0 Left 909104501 1:71391896-71391918 CCAGCTGCTCTGGCCATGGCTGA No data
Right 909104505 1:71391919-71391941 AAGGGACCAACATTGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909104501 Original CRISPR TCAGCCATGGCCAGAGCAGC TGG (reversed) Intergenic