ID: 909104504

View in Genome Browser
Species Human (GRCh38)
Location 1:71391909-71391931
Sequence ATGTTGGTCCCTTTCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909104504_909104508 2 Left 909104504 1:71391909-71391931 CCATGGCTGAAAGGGACCAACAT No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data
909104504_909104507 -7 Left 909104504 1:71391909-71391931 CCATGGCTGAAAGGGACCAACAT No data
Right 909104507 1:71391925-71391947 CCAACATTGAGCTCAGGCCGTGG No data
909104504_909104509 3 Left 909104504 1:71391909-71391931 CCATGGCTGAAAGGGACCAACAT No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data
909104504_909104511 22 Left 909104504 1:71391909-71391931 CCATGGCTGAAAGGGACCAACAT No data
Right 909104511 1:71391954-71391976 AGGGTGCAAGCCCAAAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909104504 Original CRISPR ATGTTGGTCCCTTTCAGCCA TGG (reversed) Intergenic