ID: 909104505

View in Genome Browser
Species Human (GRCh38)
Location 1:71391919-71391941
Sequence AAGGGACCAACATTGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909104497_909104505 9 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104505 1:71391919-71391941 AAGGGACCAACATTGAGCTCAGG No data
909104500_909104505 1 Left 909104500 1:71391895-71391917 CCCAGCTGCTCTGGCCATGGCTG No data
Right 909104505 1:71391919-71391941 AAGGGACCAACATTGAGCTCAGG No data
909104501_909104505 0 Left 909104501 1:71391896-71391918 CCAGCTGCTCTGGCCATGGCTGA No data
Right 909104505 1:71391919-71391941 AAGGGACCAACATTGAGCTCAGG No data
909104498_909104505 8 Left 909104498 1:71391888-71391910 CCTGTGTCCCAGCTGCTCTGGCC No data
Right 909104505 1:71391919-71391941 AAGGGACCAACATTGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909104505 Original CRISPR AAGGGACCAACATTGAGCTC AGG Intergenic