ID: 909104508

View in Genome Browser
Species Human (GRCh38)
Location 1:71391934-71391956
Sequence AGCTCAGGCCGTGGCTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909104497_909104508 24 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data
909104504_909104508 2 Left 909104504 1:71391909-71391931 CCATGGCTGAAAGGGACCAACAT No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data
909104498_909104508 23 Left 909104498 1:71391888-71391910 CCTGTGTCCCAGCTGCTCTGGCC No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data
909104500_909104508 16 Left 909104500 1:71391895-71391917 CCCAGCTGCTCTGGCCATGGCTG No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data
909104501_909104508 15 Left 909104501 1:71391896-71391918 CCAGCTGCTCTGGCCATGGCTGA No data
Right 909104508 1:71391934-71391956 AGCTCAGGCCGTGGCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909104508 Original CRISPR AGCTCAGGCCGTGGCTTCAG AGG Intergenic