ID: 909104509

View in Genome Browser
Species Human (GRCh38)
Location 1:71391935-71391957
Sequence GCTCAGGCCGTGGCTTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909104501_909104509 16 Left 909104501 1:71391896-71391918 CCAGCTGCTCTGGCCATGGCTGA No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data
909104504_909104509 3 Left 909104504 1:71391909-71391931 CCATGGCTGAAAGGGACCAACAT No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data
909104498_909104509 24 Left 909104498 1:71391888-71391910 CCTGTGTCCCAGCTGCTCTGGCC No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data
909104497_909104509 25 Left 909104497 1:71391887-71391909 CCCTGTGTCCCAGCTGCTCTGGC No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data
909104500_909104509 17 Left 909104500 1:71391895-71391917 CCCAGCTGCTCTGGCCATGGCTG No data
Right 909104509 1:71391935-71391957 GCTCAGGCCGTGGCTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909104509 Original CRISPR GCTCAGGCCGTGGCTTCAGA GGG Intergenic