ID: 909112613

View in Genome Browser
Species Human (GRCh38)
Location 1:71498751-71498773
Sequence GTATGCACATTGATTGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909112613_909112618 23 Left 909112613 1:71498751-71498773 CCAAGCCCAATCAATGTGCATAC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 909112618 1:71498797-71498819 TGCCTTAATCATAGGAGACCTGG No data
909112613_909112617 15 Left 909112613 1:71498751-71498773 CCAAGCCCAATCAATGTGCATAC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 909112617 1:71498789-71498811 AGATCATTTGCCTTAATCATAGG No data
909112613_909112620 26 Left 909112613 1:71498751-71498773 CCAAGCCCAATCAATGTGCATAC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 909112620 1:71498800-71498822 CTTAATCATAGGAGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909112613 Original CRISPR GTATGCACATTGATTGGGCT TGG (reversed) Intronic
903190636 1:21653758-21653780 ATGTGCACAGTGCTTGGGCTGGG + Intronic
903624849 1:24723287-24723309 GTAGGCAGATTGCTTGTGCTGGG - Intergenic
905951138 1:41951909-41951931 GTATGCACACTGATATGGTTTGG - Intronic
909112613 1:71498751-71498773 GTATGCACATTGATTGGGCTTGG - Intronic
911278159 1:95889788-95889810 GTATGATAATTGAGTGGGCTGGG + Intergenic
912488030 1:110044443-110044465 GTATGCTGATTGTTTGGGATAGG + Intronic
912926233 1:113915643-113915665 ATATGCACATGGGCTGGGCTGGG - Intergenic
916444341 1:164858128-164858150 GCAAGCACACTGATTGAGCTGGG - Intronic
917168672 1:172144547-172144569 GTCTGCACATTGGTTAGACTGGG - Intronic
919010504 1:191955232-191955254 TTATGTACATTGATTTTGCTTGG + Intergenic
919954989 1:202404794-202404816 GTATAAACATTATTTGGGCTGGG - Intronic
919996307 1:202754452-202754474 GTGTGCACATTGAGGGGGCAAGG - Intronic
921889958 1:220343776-220343798 GTCTGCACATTTTTTTGGCTGGG - Intergenic
922111098 1:222556431-222556453 GGAACCACATTGATTGGGTTGGG + Intergenic
922329573 1:224562471-224562493 GGATATACATTGATTTGGCTGGG + Intronic
922926730 1:229353610-229353632 GTGGGCACATTGATTGAGCTTGG - Intergenic
924374315 1:243389403-243389425 GCATGCACATGTATTGTGCTTGG + Intronic
1063933211 10:11050351-11050373 GTCTGGACATTATTTGGGCTTGG + Intronic
1072263506 10:93704991-93705013 GAATGCACATTTGTTGGGCGCGG - Intergenic
1074464001 10:113666143-113666165 GTATGCTCACTGACTTGGCTTGG - Intergenic
1075307224 10:121378615-121378637 TTATGCACTTTGAATGTGCTGGG - Intergenic
1075744561 10:124717705-124717727 GTATGCATAAGGATTGAGCTTGG - Intronic
1076124018 10:127960635-127960657 GTTTACACATTTATTGAGCTAGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1086358660 11:86033952-86033974 ATTTGCACATGTATTGGGCTCGG - Intronic
1092758008 12:11783094-11783116 TTAAGCAGATTGATTGGGCAAGG + Intronic
1104091800 12:125523859-125523881 GGATGCACTTTCATTGTGCTTGG + Intronic
1111293899 13:86255660-86255682 GTGTGCATATAGATTGGTCTAGG + Intergenic
1115122402 14:29953142-29953164 GTATACTCATTGATTGTGCTAGG - Intronic
1115284644 14:31703765-31703787 GCATGCAAATTGATATGGCTTGG - Intronic
1116275097 14:42823188-42823210 GTATGGACATTGATATGGTTTGG + Intergenic
1129794269 15:78364085-78364107 GTCTGCACAGTGAGAGGGCTGGG + Intergenic
1134863760 16:17585826-17585848 GTATGTACATTGATATGGTTTGG - Intergenic
1135124846 16:19800073-19800095 GTGTGCATATAGATTGGTCTAGG - Intronic
1136513157 16:30751480-30751502 GGATGCACATTAACGGGGCTTGG - Intronic
1137867695 16:51917754-51917776 GTAGGGACAGGGATTGGGCTGGG - Intergenic
1140302568 16:73772521-73772543 GTATGCACAGTGATATGGTTTGG - Intergenic
1147475002 17:40702468-40702490 GTCTGCACATTTATTGGACTAGG + Intronic
1151230256 17:72679661-72679683 GTATTGATCTTGATTGGGCTGGG + Intronic
1155756447 18:29503199-29503221 TTTTGCACATAGATTTGGCTTGG - Intergenic
1157973650 18:52300078-52300100 GTATGCACAGTGATATGGTTTGG - Intergenic
1158231099 18:55256372-55256394 GTCCGCAGATTAATTGGGCTGGG + Intronic
1162461675 19:10817422-10817444 GTCTGCACATTGGTTAGGCTGGG - Intronic
1164063379 19:21694167-21694189 ATATGCTGATTGATGGGGCTGGG - Intergenic
929123529 2:38502651-38502673 GTATGCTGATTGGTTGGGTTGGG - Intergenic
929361888 2:41101724-41101746 GAATGCTGATTGATTGGGTTGGG - Intergenic
931633139 2:64319326-64319348 TTATGCACTTTGATAGGGTTAGG + Intergenic
932474288 2:71991823-71991845 GTATTCCCATGGATGGGGCTGGG - Intergenic
945777114 2:214118755-214118777 GTATGGACATTGATATGGTTTGG - Intronic
1171418140 20:24997484-24997506 GTCTTCACATTGAGTAGGCTGGG - Intergenic
1174815409 20:53682989-53683011 GTGGGCAAATTGATTGAGCTCGG + Intergenic
1178317206 21:31576623-31576645 GCATGCACTCTGATTGGCCTGGG - Intergenic
949134063 3:541303-541325 TTATGCACATTTATTTGCCTAGG + Intergenic
949854992 3:8453202-8453224 GTAGGCCCATTGTTTGGCCTCGG - Intergenic
953168331 3:40485086-40485108 ATATGCATATTAATGGGGCTGGG - Intronic
954145093 3:48630555-48630577 GCATGCACATTGCTTTGCCTGGG - Intronic
956362282 3:68461342-68461364 ATATGCACTTTCATTGGCCTGGG - Intronic
956818510 3:72930747-72930769 GTATGAAAATTAGTTGGGCTTGG - Intronic
961644114 3:128383332-128383354 GTATGCTCAGTGAATGGGGTGGG + Intronic
962619804 3:137166786-137166808 GTCTTCACATTGAGTTGGCTGGG + Intergenic
965896175 3:173579243-173579265 GTGGGCAGATTGCTTGGGCTCGG + Intronic
967414735 3:189203749-189203771 GTATGAACATTGGCTGGGCAAGG + Intronic
979110180 4:116743596-116743618 GTATGGACATTAATTGCTCTTGG - Intergenic
980546906 4:134276126-134276148 GTCTTCACACTGAATGGGCTGGG + Intergenic
985440590 4:189980613-189980635 GTGTGCACCTGGATTGGGCAAGG + Intergenic
986112479 5:4733637-4733659 GGAAGCAGATTGATGGGGCTGGG + Intergenic
988674983 5:33423919-33423941 GAAAACACATTTATTGGGCTGGG + Intergenic
989392921 5:40921739-40921761 GTAAGAACATACATTGGGCTGGG + Intronic
989690100 5:44131756-44131778 TTATGCACATTGATATGGTTTGG - Intergenic
991315665 5:65302404-65302426 ATATGCACATATATGGGGCTGGG - Intronic
992123090 5:73614535-73614557 GTTTGCACAGTGATTTGGGTTGG + Intergenic
993182467 5:84572169-84572191 GTATTAACAATTATTGGGCTGGG - Intergenic
993483767 5:88456260-88456282 TTGTGTACATTGATTGTGCTTGG - Intergenic
994149332 5:96430937-96430959 GTTTTCACATTGAATGGTCTAGG + Intronic
1001579798 5:172790819-172790841 GGATGCACAGTGAATGGGCCAGG - Intergenic
1002431083 5:179204277-179204299 GTAAGCACATTCATGTGGCTGGG - Intronic
1003960739 6:11206767-11206789 GTTTGCTCATTGCTTTGGCTCGG + Intronic
1005315242 6:24597675-24597697 GTATTCCCACAGATTGGGCTAGG - Intronic
1009279503 6:61729174-61729196 GTAGGCACATGGATGGAGCTGGG + Intronic
1012968389 6:105700349-105700371 GTATGCCCATTGATATGGTTTGG + Intergenic
1014399198 6:120965926-120965948 GAATGCTGATTGGTTGGGCTGGG + Intergenic
1018694264 6:166379096-166379118 GTGTGGACTTTGATTGGGCCTGG - Intronic
1020704452 7:11526591-11526613 ATATGCACATTTATTGTGCTTGG - Intronic
1026478091 7:70754198-70754220 TAATGAACATTGATTGGGCAGGG + Intronic
1030832269 7:114239598-114239620 GCATTCACATTCACTGGGCTAGG - Intronic
1039360492 8:36871715-36871737 GTATGGAAATTGATTTGGCTGGG + Intronic
1039425639 8:37483407-37483429 GCATCCATATTGTTTGGGCTTGG - Intergenic
1044952908 8:97451153-97451175 GAATGCTAATTAATTGGGCTGGG - Intergenic
1045619785 8:103962380-103962402 GTAAGCACTTTGAGTGGGGTAGG - Intronic
1052316120 9:27117954-27117976 GTATTGACATTGCTGGGGCTGGG + Intronic
1061059802 9:128244738-128244760 GTCTGCACATTGGTTAGGCTGGG - Intronic
1062223690 9:135436219-135436241 GTTTCCACATTGAATGGTCTTGG - Intergenic
1187852163 X:23601745-23601767 GTTTACCCATTGATTGGACTAGG + Intergenic
1189854613 X:45210969-45210991 GTATACAGATTTATTGGGATGGG - Intergenic
1196068550 X:111493420-111493442 GCAGGCACATTGAATGGGATAGG - Intergenic
1196468385 X:115995637-115995659 GTAGGGACATGGATGGGGCTGGG - Intergenic
1197339336 X:125246405-125246427 GTCTGGACATTGATTAGTCTAGG + Intergenic
1197552474 X:127910084-127910106 GTATGAACATGGATGGAGCTGGG + Intergenic
1199786569 X:151111798-151111820 GCATGCTCATTGGTTGGGGTGGG + Intergenic