ID: 909115021

View in Genome Browser
Species Human (GRCh38)
Location 1:71522714-71522736
Sequence GTGTGTAAGGGGGGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 363}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909115021 Original CRISPR GTGTGTAAGGGGGGGGTAGA GGG (reversed) Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
900291516 1:1925636-1925658 CTGTGTAGAGGAGGGGTAGAGGG + Intronic
900304670 1:1999396-1999418 GTGTGTTAGCGGGGAGTCGATGG + Intronic
900506755 1:3033110-3033132 GTGTGTAAGGCGTGGGGAGTGGG + Intergenic
900649560 1:3724168-3724190 GTGTGAAAGGCTGGGGTAGGGGG + Intronic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
902742319 1:18447328-18447350 GTGTGTATGGTGGGGGTTGGGGG + Intergenic
903407654 1:23111762-23111784 GTGTGTAAGGTGGGTGGGGAGGG - Intronic
903853671 1:26322873-26322895 TTGAGTAAGGGGGAGGTAGCAGG - Intronic
904580543 1:31540509-31540531 GTATGTAGAGGGAGGGTAGATGG + Intergenic
906422989 1:45686608-45686630 GTGTGTAAGGCGGGGTCGGACGG - Exonic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
908673076 1:66570295-66570317 GTTTGGAAGTGGGGTGTAGAGGG + Intronic
908954912 1:69612918-69612940 GCTTGTAATGGGGGAGTAGAAGG - Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909236715 1:73161975-73161997 CTGTGTGAGGGGGTGGTACAGGG + Intergenic
909331054 1:74411506-74411528 GTGTGTCAGGGTGGGGGAGGGGG - Intronic
909724225 1:78814628-78814650 ATGTGTAGAGTGGGGGTAGATGG - Intergenic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
911745619 1:101438888-101438910 GTGTGTATGGGTGGGGGTGAGGG + Intergenic
911754446 1:101536817-101536839 GTGTGGAAAGGGTGGGAAGACGG + Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912660597 1:111526173-111526195 GTGTGTGGTGGGGAGGTAGAGGG - Intronic
912727949 1:112075944-112075966 GTGGGTAAGGGATGGGTGGATGG + Intergenic
912746189 1:112247483-112247505 GTGTGAAAGGGGAGGTCAGAAGG + Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913611401 1:120512839-120512861 GAGTGTAGGTGGGGTGTAGATGG + Intergenic
914579791 1:149009400-149009422 GAGTGTAGGTGGGGTGTAGATGG - Intronic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916296435 1:163225581-163225603 GTGTGTGTGGGGTGGGTAGGGGG - Intronic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917722113 1:177795874-177795896 GTGGGTAAGGGGTGGGAATAAGG - Intergenic
923471016 1:234291130-234291152 GTGTGTCAGGGAGGGGTTGGTGG - Intronic
923514117 1:234680305-234680327 GTGTGTGTGGGGGGGGCATATGG + Intergenic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1063392341 10:5658825-5658847 GTGGGGAAGGGAGGGATAGAAGG + Intronic
1065021669 10:21507100-21507122 GTGTGTATGTGGGGGGTGGGAGG - Intergenic
1065021893 10:21508566-21508588 GTGTGTAAGAGGGAGAGAGAGGG + Intergenic
1067256785 10:44649455-44649477 GTGTGGGAGGGGGCGGGAGAAGG - Intergenic
1067616978 10:47763783-47763805 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1069617845 10:69817602-69817624 GTGTGCAGGGGTGGGGTAGGAGG + Intronic
1070285977 10:75084058-75084080 GTGTGTGAGGGGGGTGGAGTTGG + Intergenic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072761449 10:98060322-98060344 GTGTGGCAGGATGGGGTAGAGGG - Intergenic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073248961 10:102110201-102110223 GTGTGTAAGGGCCAGGTATATGG - Intronic
1073481563 10:103789170-103789192 GGGAGGATGGGGGGGGTAGAAGG + Intronic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1075539793 10:123302511-123302533 GTGTGCATGGTGGGGGTAGGGGG + Intergenic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1077916755 11:6616616-6616638 GTGGGGAAGGGGGTGGGAGATGG - Intronic
1077924092 11:6663270-6663292 GTGTGTAAGTGTGTGGTAGTGGG + Intergenic
1078088921 11:8251726-8251748 GTGTGTATGGGGGGGGTATAGGG + Intronic
1078451952 11:11447081-11447103 GTGTGTAAGGGGGCAGTAGTTGG - Intronic
1078910080 11:15722991-15723013 CTGTGAAAGGGAGGGGCAGAGGG + Intergenic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080290359 11:30664160-30664182 GGGTGTAAATGAGGGGTAGAGGG + Intergenic
1080892393 11:36420322-36420344 GTGTGTAGGGGGGCAGTATAGGG + Intronic
1085058549 11:73423671-73423693 GTGGTTAAGGGGTGGGGAGAAGG - Intronic
1085198096 11:74684174-74684196 CTGTGTAAAGGAGGGGTTGAAGG + Intergenic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1085670303 11:78457962-78457984 GTGTGTAACGGGGGCTTGGAAGG + Intronic
1086738873 11:90341806-90341828 GTGTGTAAGGGAGGAAGAGAGGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087212135 11:95455307-95455329 GTCTCTGAGGGTGGGGTAGAGGG + Intergenic
1088247969 11:107837901-107837923 GTGTATAAGGTGGGGGTGGGTGG - Intronic
1089588304 11:119523901-119523923 GTGTGTAAGGGCCGGGGAGCAGG + Intergenic
1091087161 11:132732634-132732656 GTGTGTAAGGGGAGGCTTCAGGG + Intronic
1091144539 11:133266225-133266247 GTGTGCTAGGGTGGGGTTGAAGG - Intronic
1092045799 12:5431344-5431366 GTGTGGAAGGGAGAGGGAGATGG - Intergenic
1094467787 12:30771957-30771979 GTGTGTGGGGGGGGGGGAGGGGG - Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095520746 12:43062050-43062072 GAGTGGAAAGAGGGGGTAGAAGG - Intergenic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1097227762 12:57488567-57488589 GTGTGTTAGGAGGGGAGAGAGGG - Intronic
1098115591 12:67173099-67173121 GTGTGTTAGTGGGGGGATGAAGG - Intergenic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1100693174 12:97061521-97061543 GTGGGTTCGGGGCGGGTAGAGGG + Intergenic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1104376625 12:128268879-128268901 GTGAGAGAGGGGGGGGAAGAAGG + Intronic
1104521517 12:129480193-129480215 GTGTGCAAGGGAGAGGAAGAAGG + Intronic
1105296035 13:19088698-19088720 GTGTGTGAGGGCTGGGTAAATGG - Intergenic
1105821875 13:24087287-24087309 GTGTGCAGGGGGTGGGTAGCAGG - Intronic
1106002598 13:25738335-25738357 GTGTGTGGGGGGGGGGGAGGGGG - Intronic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106310575 13:28550418-28550440 GTGTGTGGGGGGTGGGTAGCGGG + Intergenic
1106674798 13:31947300-31947322 GTGTGTTAGGGGGAAGGAGAGGG + Intergenic
1108058382 13:46507982-46508004 GGGTTTAAGGGGAGGGTAGGTGG - Intergenic
1109193208 13:59350117-59350139 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1112184047 13:97111457-97111479 GTCTGTAAGGCGGGGGGAGCGGG - Intergenic
1112447373 13:99476574-99476596 GTGTGTGGGGGGGGGGTGGCGGG - Intergenic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1112657788 13:101470676-101470698 GTGTGTGTGGGAGGGGTGGAGGG + Intronic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1115426868 14:33270477-33270499 GTGTGTAAGAGAGAGGGAGAAGG + Intronic
1117202275 14:53403575-53403597 GACTGTAACAGGGGGGTAGAGGG - Intergenic
1118891875 14:69916762-69916784 GGGTGTAAGGAGGGTGAAGATGG - Intronic
1119196011 14:72717068-72717090 CTGTGTAAGTGGGTTGTAGATGG - Intronic
1120843733 14:89108562-89108584 GTGTGTATGGGCGGGGGAGTGGG - Intergenic
1120945452 14:89991081-89991103 GTGTGTAAAGGTGAAGTAGAAGG + Intronic
1122452563 14:101822073-101822095 GTGTGTGGGGGGGGGGCAGGGGG - Intronic
1123208754 14:106738666-106738688 GTGTGTGTGGGGGGGGTAGGTGG - Intergenic
1124272464 15:28295303-28295325 GTGTGTGGGGGGGGGGGAGTGGG + Intronic
1125985370 15:44045707-44045729 GAGTGTAAGGAAGGGGCAGAAGG + Intronic
1126408330 15:48345896-48345918 GTGTGTGAGGAGGGTGTATATGG - Intergenic
1127093734 15:55492339-55492361 GTAGATAAGGGGTGGGTAGAGGG + Intronic
1127151988 15:56085290-56085312 GTGTATGTGGTGGGGGTAGAAGG + Intergenic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127387447 15:58477988-58478010 GTGTGCATGGGGTGGGTATAGGG - Intronic
1127412268 15:58721550-58721572 GTGTGTGGGGTGGGGGCAGAGGG - Intronic
1127618803 15:60713316-60713338 GTGGGTAAAGTGGGGGTAGGAGG - Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128585256 15:68843869-68843891 GTATGTGTGTGGGGGGTAGAGGG - Intronic
1131177580 15:90219712-90219734 GTGTGGAAGGGGGGGCTCGGCGG + Intronic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1131744122 15:95427363-95427385 GTGTGTATATGGGGGATAGATGG - Intergenic
1132045178 15:98557625-98557647 GTGTGTAATGGCGGGGTGGGGGG + Intergenic
1132530505 16:445952-445974 CTGTGTGAGGTGGGGGTAGGTGG + Intronic
1132563679 16:610729-610751 GTGGGGCAGGGCGGGGTAGAGGG - Intronic
1133382250 16:5341145-5341167 ATGAGTAAGGGGGGAGTAGGAGG + Intergenic
1134006570 16:10822225-10822247 GTGGGTAGGGGGAGGGGAGAGGG - Intergenic
1134071137 16:11260456-11260478 GTGTCTCAGTGGCGGGTAGAGGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1135295691 16:21277712-21277734 GTGTCTAAGGGAAGGGCAGAGGG - Intronic
1136330842 16:29575417-29575439 GTGTGTATGGGGAGGGCAGGTGG - Intergenic
1136445477 16:30315145-30315167 GTGTGTATGGGGAGGGGAGGTGG - Intergenic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1137701361 16:50500314-50500336 GGGTGGAAGGGCGGGGCAGAGGG + Intergenic
1137789892 16:51166107-51166129 GTTTGTCAGAGAGGGGTAGATGG + Intergenic
1138349495 16:56338914-56338936 GTGTGGAAGGGTGGGGGAAATGG - Intronic
1138970440 16:62136299-62136321 GTGTTTATGGGGGGGGGTGAGGG + Intergenic
1139340961 16:66267580-66267602 GTGTGTGGGGGGGGGGTAACAGG - Intergenic
1139910602 16:70395176-70395198 CTGTGGAAGGGAGGGGAAGATGG + Intronic
1140245290 16:73242839-73242861 GTGTGGAGGTGTGGGGTAGAGGG + Intergenic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1143149850 17:4801125-4801147 GTGTGTGCTGGGGGTGTAGATGG - Intergenic
1143387606 17:6541195-6541217 GTGTCTCAGGAGGGGTTAGAGGG + Intronic
1143873942 17:9977744-9977766 GTGGGGAAGGGGGGGGTTGGGGG + Intronic
1144667905 17:17114697-17114719 GTGGGTGGGCGGGGGGTAGATGG - Intronic
1144789207 17:17848135-17848157 GTGGGCAAGGGTGGGGTAGGTGG - Intronic
1146688329 17:34856616-34856638 GGGGGTTAGGGGAGGGTAGAGGG + Intergenic
1146925484 17:36742043-36742065 GTGTGTGAGAGGGAGGAAGAGGG + Intergenic
1147387251 17:40089815-40089837 GTGTGTAGGGGGTGAGTTGAGGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147600323 17:41741143-41741165 GTGTGGAAGGCTGAGGTAGAGGG - Intergenic
1147632746 17:41942658-41942680 GTGGGCAAGGGGGAGGGAGAAGG + Intronic
1149344246 17:55718190-55718212 GTGTGTAAGGGTGGGATAAATGG + Intergenic
1150368520 17:64613738-64613760 GTGTGTGGAGGGGGGGCAGAGGG + Intronic
1150513165 17:65777544-65777566 GTGTGTAGGGTGTGGGTAGTGGG - Intronic
1151889315 17:76942858-76942880 GTTTGCAAGGGGAGGGGAGAGGG - Intronic
1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153852122 18:9104702-9104724 GGGTGGAAGGGGGAGGGAGAAGG - Intronic
1153946359 18:10021564-10021586 GTGGGTAGGTGGGAGGTAGATGG - Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159893065 18:73971385-73971407 GTGTGTAAGAGGGAGATACAAGG - Intergenic
1161724549 19:5921007-5921029 GTGTGTGAGGGTGGTGTTGAGGG + Intronic
1161899320 19:7106137-7106159 GGGTGCAAGAGGGGAGTAGATGG + Intergenic
1162742637 19:12782405-12782427 GTGTGTAGGGGGCGGGAAGTGGG + Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163091331 19:15022135-15022157 GTGTGTGAGGGGGGAGGACAGGG - Intronic
1163200938 19:15768610-15768632 TTGTGTAAGGGGGAAGGAGAAGG - Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1166100788 19:40570411-40570433 GTGTGAAGGGAGGGGGAAGAGGG - Intronic
1166124428 19:40705266-40705288 GTGGGTAGGGCTGGGGTAGAAGG + Intronic
1166196231 19:41207567-41207589 GTGAGTAAGGGGTGGGGACAGGG + Intergenic
1166203647 19:41254576-41254598 GAGGGTAAGGGGAGGGTAGAAGG + Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167114893 19:47483456-47483478 GTGTGTAAGGAGGAGGGCGAAGG + Intronic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1168279051 19:55294248-55294270 GTGAGTGAGGGGCGGATAGAGGG + Intronic
1168474957 19:56668899-56668921 GTGTGTAGGGGGAGGGCAGGTGG + Intronic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
926103644 2:10136860-10136882 GGGGGTGAGGGGTGGGTAGAAGG + Intergenic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926351229 2:11996639-11996661 GTGTGTTGGGGGGTGTTAGAGGG + Intergenic
926372691 2:12196444-12196466 GTGTGTGTGGTGGGGGTAGGAGG - Intergenic
926728923 2:16020046-16020068 GAGTGGAAGGTGGGGGTTGAGGG + Intergenic
927705879 2:25296336-25296358 CTGTGTAAGGGGCGGGCAGGAGG + Intronic
929932450 2:46269462-46269484 GTGTGTGAGGTGGGGGTGGGTGG - Intergenic
930644022 2:53884571-53884593 GTATGTAAGAGGTTGGTAGAAGG - Intronic
930929328 2:56861653-56861675 GTGAGAAAGGGGGTGGAAGAAGG + Intergenic
931186938 2:59961973-59961995 GTGATGAAGGTGGGGGTAGAAGG - Intergenic
931694920 2:64864610-64864632 GTGTGTCGGGGGAGGGTATAAGG - Intergenic
932304340 2:70691222-70691244 GTGTGTGAGGTGGGGGGAGTGGG - Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934609916 2:95727482-95727504 ATGTGTGAGGTGGGGGTAGGAGG + Intergenic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
935135829 2:100301036-100301058 GTGTGTAAGGACCAGGTAGAAGG - Intronic
935386897 2:102509306-102509328 GTGTGGAAGAGGGAGGCAGAAGG - Intronic
935981660 2:108634194-108634216 GTCTGTAGGGGGAGGGAAGAAGG + Intronic
936543243 2:113369059-113369081 ATGTGTGAGGTGGGGGTAGGAGG + Intergenic
937012525 2:118574970-118574992 GTGTGTATGGTGTGGGTAGCAGG - Intergenic
939648746 2:144735747-144735769 GTGTGTTGGGGAGGGGAAGAGGG + Intergenic
940064684 2:149614162-149614184 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
942292057 2:174483018-174483040 GTGTGTGTGGCGGGTGTAGAAGG - Intronic
943331758 2:186568209-186568231 ATGTGTATGGTGGGGGTAGTGGG + Intergenic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
945026880 2:205628118-205628140 GTGTGTGACTGGGTGGTAGAGGG + Intergenic
946842930 2:223836397-223836419 GTGTGTAAGGGCAGGGGATAGGG - Intronic
947245724 2:228046063-228046085 GTGTGTAGGGGGTGGGATGAAGG - Intronic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
948259116 2:236590024-236590046 GTGGGGAAGGGCCGGGTAGAGGG - Intergenic
948279946 2:236739252-236739274 GTGGATGAGTGGGGGGTAGATGG + Intergenic
1169922774 20:10753174-10753196 GTGTGAGAGAGGGGGATAGAGGG + Intergenic
1170465161 20:16616134-16616156 GTGAGTGATGAGGGGGTAGAAGG - Intergenic
1171388769 20:24787478-24787500 TTGTGTCAGGGAGGGGAAGAAGG - Intergenic
1172107084 20:32523206-32523228 GGGTGGAAGGGGAGGATAGAAGG + Intronic
1172207801 20:33176768-33176790 GTGAGTAAGGGGAGGGTACAGGG - Intronic
1172639679 20:36433159-36433181 GTGAGCGAGGGAGGGGTAGATGG + Intronic
1173381951 20:42553369-42553391 GAGTGGAAGGGGGAGATAGAAGG - Intronic
1173628963 20:44495661-44495683 CTGTGTAAGGAGGGGGCAGGGGG - Intergenic
1173675931 20:44835775-44835797 GTGTGTATGTGGGGGGTGGGGGG - Intergenic
1173881084 20:46412710-46412732 GTGTGTGGGGGGGGGGTTGTTGG + Intronic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1176510589 21:7745043-7745065 GTGTGTGACGTCGGGGTAGAAGG + Intronic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1177673585 21:24267269-24267291 GTGTGGGAGGTGGGGTTAGACGG - Intergenic
1178644702 21:34375572-34375594 GTGTGTGACGTCGGGGTAGAAGG + Intronic
1179392143 21:41003668-41003690 GTGTGTTGGGGGGGGAGAGAGGG + Intergenic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1181339308 22:22165672-22165694 CTGTGTAAGTGAGGGGCAGAAGG + Intergenic
1181892504 22:26076010-26076032 GTGTGTAGGGTGGGTGGAGAGGG - Intergenic
1184046666 22:41976580-41976602 GTGGGTAAGGGGCGGGGAGCAGG + Intronic
949808548 3:7981282-7981304 GTCTGTCAGGGGGCGGGAGAGGG - Intergenic
950053211 3:10007583-10007605 GGGTGTCAGGGGAGGGTTGATGG + Intronic
952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG + Intronic
953176628 3:40559381-40559403 GTGTGTAATAGGTAGGTAGAAGG - Intronic
954008056 3:47608921-47608943 GTTTGTGTGGGGGGGTTAGAAGG + Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954414346 3:50385681-50385703 GTGTGCCAGGGGTGGGCAGATGG - Intronic
954436401 3:50498592-50498614 GTGTATACGTGGGAGGTAGATGG + Intronic
954934027 3:54310484-54310506 GTGTGTATTGGGGGGGCAGAGGG - Intronic
956409169 3:68961196-68961218 GTGAATAAGGGGGGGGTAATTGG + Intergenic
958502795 3:94936370-94936392 GAGTGTAAGGGGATGGTAGCAGG - Intergenic
959931119 3:111984169-111984191 GTATGTAAGAGATGGGTAGAAGG - Intronic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961849703 3:129803337-129803359 GAGAGTGAGGGGAGGGTAGAAGG + Intronic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962894731 3:139704151-139704173 GTGGGTAAGGTGGGGGAGGAGGG + Intergenic
964315199 3:155436228-155436250 ATGTGTAAGGTGGGGGTAGGAGG - Intronic
964891444 3:161540829-161540851 GTGTGTCTGGGGGTGGTACAAGG + Intergenic
965519822 3:169661300-169661322 GTGTGTGTGGGGGGGGGAGTTGG - Intronic
968621205 4:1604203-1604225 GTGTGGATGGGTGGGGAAGAAGG + Intergenic
969457490 4:7308406-7308428 GTGTTTGGGGTGGGGGTAGATGG + Intronic
969840854 4:9880636-9880658 GTGTGCATGGGTGGGGAAGAAGG + Intronic
971043431 4:22779211-22779233 GTGGGTGGGGGGGGGGTAGAGGG - Intergenic
971369855 4:26009664-26009686 GTGTGTATGTGGCGGGTAGTAGG - Intergenic
971412650 4:26391450-26391472 GTGTGTGGGGGGTGGGTTGAAGG - Intronic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
973110349 4:46390197-46390219 GTGTGTGGGGGGGGGGGAGGGGG - Intronic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973570479 4:52233939-52233961 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
973773774 4:54228078-54228100 GTGTGTTGGGGTGGGGTTGAGGG + Intronic
975752681 4:77539848-77539870 GTGTGTGTGGTGGGGGTAGGGGG + Intronic
976356639 4:84126561-84126583 GTGACCAAGGTGGGGGTAGAAGG + Intergenic
977799824 4:101213986-101214008 GTTTGAAAGTGGGGGGAAGATGG - Intronic
978085418 4:104646166-104646188 GTGTGTAAGAGGTGGGGAGAAGG + Intergenic
981081112 4:140640321-140640343 GTGTGAAAAGGTGGGGAAGAGGG + Intronic
981550068 4:145935057-145935079 GTGTGTAACGGAGGAGGAGAAGG - Intronic
981782699 4:148444966-148444988 GTGTGTGAGGGGGCGGTCGCAGG + Intergenic
982149294 4:152434953-152434975 GTGTGTGGGGGGGGGGGAGCGGG - Intronic
983828450 4:172295720-172295742 GTGTGTGTGGGAGGGGTAGAGGG - Intronic
983968852 4:173846394-173846416 ATGTGGAGGGTGGGGGTAGAAGG + Intergenic
985234188 4:187854944-187854966 GGGTGTAAGGGGAGGGGAAATGG + Intergenic
985516105 5:345490-345512 GTGTGTATGTGGGGGGGAGGGGG + Intronic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
990464864 5:56062071-56062093 TTGTGTAAGGGTGTGGAAGAAGG + Intergenic
990863974 5:60359830-60359852 GTGTGTTTTGTGGGGGTAGATGG - Intronic
991016721 5:61940994-61941016 GTGTGGTAGGTAGGGGTAGAAGG - Intergenic
991491156 5:67183796-67183818 GTGTGTAAGGGAGGGGAAATTGG + Exonic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
994652556 5:102546872-102546894 GTGTGTTAGGGGCTGGGAGAGGG - Intergenic
995556096 5:113330657-113330679 TTGTGTAGGGGAGGGGAAGAGGG - Intronic
997510471 5:134450388-134450410 GTGTGTAAGGGGGATGTAGTGGG + Intergenic
998849917 5:146342703-146342725 TTGTGCAAGGCGGGGGTAAAGGG - Intergenic
999418919 5:151423879-151423901 GTGTGTAGGGAGAGGGTATATGG + Intergenic
999483221 5:151967788-151967810 GTCTGTGCCGGGGGGGTAGAGGG - Intergenic
1000004362 5:157169433-157169455 GTGTGTAGGGGAGGGGAAGGTGG + Intronic
1000042361 5:157494234-157494256 GTGGGTGAGTGGGTGGTAGATGG + Intronic
1001381794 5:171310501-171310523 GTGTGTTTGGGGGAGGCAGAGGG - Intronic
1001722867 5:173870783-173870805 GTGTGGTAGGGGGGCATAGAGGG + Intergenic
1002676026 5:180913544-180913566 GGGTGTAAGGTGGTGGTACAAGG + Intronic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1006590092 6:35148678-35148700 TTGTGTGAGGGTGGGGGAGACGG - Intergenic
1006795712 6:36731124-36731146 GTGTGTAGGGGTGGGGGAGATGG - Intronic
1007168417 6:39845127-39845149 GTGTGTAATGTGTGTGTAGATGG - Intronic
1007380759 6:41488755-41488777 GTGTGTCAGTGGGGAGCAGATGG + Intergenic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007854254 6:44838416-44838438 CTGTGTAAGAGGGCAGTAGAGGG + Intronic
1008289206 6:49692969-49692991 GTGTGTGGGGAGGGGGTAGGAGG + Intronic
1008370312 6:50723824-50723846 GTGTGTATGGCGGGGGTTGGGGG - Intronic
1008936421 6:56997414-56997436 GTGTGTATGTGGTGGGGAGATGG - Intronic
1009960572 6:70515840-70515862 ATGTGTAGGGGTGGGGAAGAGGG + Intronic
1010951996 6:82048253-82048275 GTGTGTGAGTGAGGGTTAGAAGG - Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1012790101 6:103682408-103682430 GTGTGTAGGGGGGTGGGGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013422398 6:109978581-109978603 GTGTGTATGGGGGCAGCAGAGGG - Intronic
1013726961 6:113110468-113110490 GTATGTATGGGGTGGGTAAATGG - Intergenic
1014432907 6:121390493-121390515 GTTGGTTGGGGGGGGGTAGATGG - Intergenic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018801282 6:167224263-167224285 GTGTGAAAAGGAGGGGAAGAGGG - Intergenic
1019776006 7:2912651-2912673 GTGGGTGAGGGGTCGGTAGATGG - Intronic
1020701692 7:11492110-11492132 GTGTGTCAAGTGGGGGCAGATGG - Intronic
1021697127 7:23286348-23286370 GAGTGGAAGGAGGGGGGAGAGGG - Intergenic
1021708934 7:23396005-23396027 TTGTGTAGGGGTGGGGTAGGGGG - Intronic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1022313285 7:29218182-29218204 GGGTGGAAGGGGGTGGGAGATGG - Intronic
1022420825 7:30221750-30221772 CTGTGCATGGTGGGGGTAGAGGG + Intergenic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG + Intergenic
1022607209 7:31827266-31827288 GTGAGCTAGGGGTGGGTAGAAGG - Intronic
1023346026 7:39271985-39272007 GTGTGTGGGGGTGGGGGAGAGGG + Intronic
1023384755 7:39645306-39645328 GTGTGGGAGGTGGGGGCAGAAGG + Intronic
1027234117 7:76287576-76287598 GTGGGTAGGGATGGGGTAGAGGG + Intergenic
1028052768 7:86206761-86206783 GTGGGGAAGGGAGGGGAAGAAGG + Intergenic
1029269285 7:99367036-99367058 GTGTGCAAGGGGGCGGGAAAGGG + Intronic
1030149662 7:106390947-106390969 GTGTGTATTGGGGGGATAAAGGG + Intergenic
1030630350 7:111888723-111888745 GTGAGGAAGAGGGGGGAAGATGG - Intronic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1033016635 7:137678269-137678291 GTGTGTTGGTGGGGGGCAGAGGG - Intronic
1033026115 7:137774541-137774563 GTGTGTAGGGGGAGGGTAATGGG - Intronic
1033786473 7:144737258-144737280 GTGAATAAGGGAGGGGGAGAAGG + Intronic
1033837993 7:145338714-145338736 GTGTGTGTAGGGGAGGTAGATGG + Intergenic
1034385904 7:150740988-150741010 GTGTTTTAGATGGGGGTAGATGG - Intronic
1034416371 7:150966376-150966398 GTGTGTGGGGGGGGGGGAGGGGG - Intronic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034780707 7:153879291-153879313 GTGTGGATGCTGGGGGTAGAGGG + Intergenic
1035636685 8:1152561-1152583 GTGAGTAAGGTGGTGGTTGATGG + Intergenic
1036451337 8:8870628-8870650 GTGTGTGTGGGGTGGTTAGATGG - Intronic
1037681577 8:21102046-21102068 GTGTGTTAGGGTGGGGTTTATGG + Intergenic
1037816276 8:22114361-22114383 GTGTGTAATGATGGGCTAGAAGG + Intergenic
1038407145 8:27330618-27330640 CTGTGCAAGGGGGCGGCAGAGGG + Intronic
1038869875 8:31482152-31482174 GTGTGTATGGGGGGGTTGGGAGG + Intergenic
1039088217 8:33800788-33800810 GTCTGTAAGGGCGGGGAAGGGGG - Intergenic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1042041366 8:64594101-64594123 GTGTGTATGTGGGGGGTGGGTGG + Intronic
1042045877 8:64651024-64651046 GTGTTTGAGGTGGGGGAAGACGG + Intronic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1043789644 8:84448183-84448205 GTGTGGAAGGGTGGGCTGGAGGG - Intronic
1044715134 8:95093116-95093138 GAGTGTAAGGGGTGGGTGGGAGG + Intronic
1045815434 8:106271409-106271431 GTGTGTATTGCGGGGGTAGGGGG + Intronic
1047235549 8:123039231-123039253 GTGTGTATGGAGGGGGTTGAAGG - Intronic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048351161 8:133617844-133617866 GTGTGTATGGGGCGGGGAGGGGG + Intergenic
1051021123 9:12544167-12544189 GTGTGGAATGAGGGGGTAGGTGG - Intergenic
1053504368 9:38628846-38628868 GTGTGTATGGGGGGTGTTTATGG - Intergenic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1056544249 9:87600830-87600852 GGGTGTGAGGAGGGGGCAGAAGG + Intronic
1057588810 9:96353752-96353774 GGGTGTTAGGAGTGGGTAGAAGG - Intronic
1058993898 9:110280828-110280850 GTGTGTAGGTGGGGGTCAGAGGG + Intergenic
1059225965 9:112673253-112673275 GCCTGTCAGGGTGGGGTAGAGGG - Intergenic
1059967511 9:119629932-119629954 GTGTGTATGGTGGGGGGAGGAGG - Intergenic
1060395457 9:123313288-123313310 GTGTGCAAGGGGTGGGTACATGG + Intergenic
1061372983 9:130208214-130208236 GTGTGTGAGGTGGGGGTGGGGGG + Intronic
1061507995 9:131042916-131042938 GTGTGAAAGGGGAGAGTTGATGG - Intronic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1186819502 X:13272463-13272485 GTGTGTAAGGAGTGGGGAGGCGG - Intergenic
1186998577 X:15150843-15150865 TTGTCAAAGGGTGGGGTAGAGGG - Intergenic
1187743751 X:22385541-22385563 GTGTGGATGTTGGGGGTAGATGG - Intergenic
1189241707 X:39529667-39529689 GTGTGTGTGGTGGGGGTAGATGG - Intergenic
1190666944 X:52704831-52704853 GTGTGTGGGGTGGGGGTAGGGGG + Intronic
1190672474 X:52753577-52753599 GTGTGTGGGGTGGGGGTAGGGGG - Intronic
1192605776 X:72515582-72515604 GTGTGTGGGGGGGGGGTGGGGGG + Intronic
1194016729 X:88630656-88630678 GTCTGTCAGGGTTGGGTAGAGGG + Intergenic
1194592720 X:95819194-95819216 GTGTGTAAATGGGGGATAGATGG - Intergenic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1197630081 X:128848346-128848368 GTGTGTGTGTTGGGGGTAGATGG + Intergenic
1198143616 X:133831931-133831953 GTGTGTAAAAGGGGGGGAAATGG - Intronic
1199096597 X:143749190-143749212 GTGTGTGTGGGGGAGGTTGAAGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic