ID: 909124962

View in Genome Browser
Species Human (GRCh38)
Location 1:71656284-71656306
Sequence GCCCCTATTCTCCTTCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909124960_909124962 4 Left 909124960 1:71656257-71656279 CCGTTAGAAGGAAAGACAGTTCT 0: 1
1: 0
2: 2
3: 21
4: 280
Right 909124962 1:71656284-71656306 GCCCCTATTCTCCTTCTAACAGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909124962 Original CRISPR GCCCCTATTCTCCTTCTAAC AGG Intronic
901536083 1:9883738-9883760 GCCCCTCTTCTCCCTCTTGCAGG - Exonic
902053503 1:13582278-13582300 GCATCTATTCTCCATCTAACAGG + Intergenic
902395411 1:16129792-16129814 GCCCCTCCACTCCTACTAACAGG + Intronic
905010085 1:34741464-34741486 GCCCCTCTTCCCCTTCCCACCGG - Intronic
905092998 1:35444646-35444668 ACCCATACTCTCCATCTAACTGG + Intronic
906058988 1:42936271-42936293 GGCCCTTTCCTCCTTGTAACTGG - Intronic
907113184 1:51945808-51945830 TCACCCATTCTCTTTCTAACAGG - Intronic
909124962 1:71656284-71656306 GCCCCTATTCTCCTTCTAACAGG + Intronic
916119571 1:161516373-161516395 GAATCTATTCTCCTTGTAACAGG + Intronic
916926725 1:169529093-169529115 GCCACTATTCTCCTATTACCTGG + Intronic
917515010 1:175699915-175699937 GCTCCTATTCTCCTCCTCAGTGG + Intronic
918791191 1:188832122-188832144 CCCCTTATAGTCCTTCTAACAGG - Intergenic
920700136 1:208211746-208211768 TCCCCTGTTCTGCTACTAACTGG + Intronic
923299995 1:232631426-232631448 GCCTCTATTTACCTTTTAACAGG - Intergenic
1063227978 10:4034089-4034111 GCCCCTCTTCTCCTTCGTATTGG + Intergenic
1069113820 10:64479315-64479337 GCCCTTTTCCTCCTTCTACCAGG - Intergenic
1069311877 10:67047497-67047519 GCCTCTTTTCTCCTTGTGACAGG - Intronic
1070780608 10:79135555-79135577 GCCCCTGTTCTCTTTCTTCCTGG + Intronic
1071285963 10:84145724-84145746 TCCCCTATTCTCCTGCTATTTGG + Intronic
1075845256 10:125540112-125540134 CCCCCTATTCTCCTTCCACTTGG - Intergenic
1080119833 11:28664468-28664490 GTCCCTTTTCTTCCTCTAACAGG - Intergenic
1083539086 11:63499316-63499338 TCCCATACTCTTCTTCTAACTGG - Intergenic
1090167354 11:124563908-124563930 GCCCCTTTTCTGCTTTTATCTGG - Intergenic
1090986380 11:131770031-131770053 GGCCCTCTTCTCCCTCTCACTGG - Intronic
1091784892 12:3237403-3237425 CCACCTATTCTCCTTATACCAGG + Intronic
1094536528 12:31326314-31326336 GCCTCTATTGTCCTTTTAAGGGG + Exonic
1095393830 12:41740880-41740902 GCCCCTATTCTCCTTCTCTTGGG - Intergenic
1096638971 12:52979140-52979162 GCCCCTATTCTCTTATTAATAGG + Intergenic
1099918109 12:88921622-88921644 GCCCCTCTTCTGCTGCTAGCTGG - Intergenic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1107427252 13:40306404-40306426 CCTCCTATTCTCCATCTAATGGG + Intergenic
1119746014 14:77044459-77044481 CCCCATGTTCTGCTTCTAACTGG + Intergenic
1126357917 15:47815689-47815711 GCTCCTATCCTCCTGCTGACAGG + Intergenic
1127474134 15:59316362-59316384 GACCCTATTCTCTTTGTAATGGG - Intronic
1142360713 16:89625279-89625301 GACCCTATTCTCCTGCTCCCAGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1144472765 17:15559538-15559560 GCCAGAATTCTCTTTCTAACAGG - Intronic
1144923715 17:18785163-18785185 GCCAGAATTCTCTTTCTAACAGG + Intronic
1149207304 17:54263573-54263595 GCCCCTATCTCCCTTCTAATAGG - Intergenic
1151250060 17:72827548-72827570 GAGCCTATTCTCCATCTAAGTGG + Intronic
1151957302 17:77386752-77386774 GCCCGTATTTTCCTTCCAAGTGG - Intronic
1154435884 18:14341261-14341283 GCCCCTCTGCTCCTTATAAGTGG + Intergenic
1157331808 18:46709499-46709521 TCCCATATTCTGCTTCTAACAGG + Intronic
1158419699 18:57282039-57282061 GTGCTTCTTCTCCTTCTAACAGG + Intergenic
1159700271 18:71617659-71617681 TCCCATTTTCTTCTTCTAACTGG - Intergenic
1164269197 19:23655611-23655633 TCCCATATTCACCTTCTATCAGG + Intronic
1164530595 19:29045421-29045443 GCCCCCATTCTCCTTTGATCTGG - Intergenic
931799857 2:65748028-65748050 ACCCCTCTTCTCCTTCTCCCCGG + Intergenic
932690998 2:73913654-73913676 GCCCCTTTTCTGATTCTGACTGG + Intronic
933234043 2:79844636-79844658 GGCCCCATTTTACTTCTAACAGG - Intronic
940509204 2:154591329-154591351 GCCTCTAATCTCCTTCTGATGGG - Intergenic
942207566 2:173635880-173635902 TCCCTTATTGTCCTTGTAACAGG - Intergenic
948489123 2:238300415-238300437 GCTCCATTTCTCCTTGTAACTGG - Intergenic
1169686751 20:8283095-8283117 TCCTCTGTTCTCCTTCTTACTGG - Intronic
1171107153 20:22445435-22445457 GCCCCTCTTCAACTCCTAACTGG - Intergenic
1174894536 20:54434851-54434873 GCCCCTTTTTTTCTTCTAAGGGG - Intergenic
1176513274 21:7764439-7764461 GGCACTATTCTCCTTCTGAGTGG - Intronic
1177011076 21:15730464-15730486 GCCCCACTTCTCCTTCCGACGGG + Intronic
1177814009 21:25956392-25956414 GCTCCTATTTTCTTTCTAATTGG + Intronic
1177906034 21:26972345-26972367 CCCCCTTTTCTCCTTCCAGCTGG + Intergenic
1178378394 21:32087726-32087748 GCCTCTTTTCCCCTTGTAACTGG + Intergenic
1178388790 21:32181495-32181517 GCCTCATTTCTCCTTCTCACTGG - Intergenic
1178647387 21:34394963-34394985 GGCACTATTCTCCTTCTGAGTGG - Intronic
1179663630 21:42893872-42893894 GCCCTTCTTCTCCTTTTCACAGG - Intronic
959001870 3:100973506-100973528 GCCCTTACTCTGCTTCTAACTGG - Intronic
970301461 4:14685725-14685747 CCCCCCATGCTCCTTCCAACTGG + Intergenic
989774800 5:45191990-45192012 GCCCCTTTTCTCTTTCAACCTGG + Intergenic
991611342 5:68452653-68452675 GTATCTATTCTCCTTGTAACCGG - Intergenic
993466260 5:88250510-88250532 GCCCCTGTTCTCCATCTAAGTGG + Intronic
999586318 5:153093400-153093422 GCCCGTATTCTACTTCTCTCTGG + Intergenic
1002006706 5:176239612-176239634 GCCCCTGTTCCCTTTCTAGCTGG + Intronic
1002219670 5:177671024-177671046 GCCCCTGTTCCCTTTCTAGCTGG - Intergenic
1011452960 6:87515192-87515214 GGCCCTATTCTACTACTAAGAGG + Intronic
1012819594 6:104068727-104068749 TCCCCTATTCTCCTTTCAAATGG + Intergenic
1013078777 6:106794113-106794135 TCACCTATTCTCTTTCTCACTGG - Intergenic
1015584985 6:134766820-134766842 GCCTTCATTTTCCTTCTAACTGG + Intergenic
1020139082 7:5603007-5603029 GCCCCTATTATTTCTCTAACTGG + Intronic
1023528969 7:41133852-41133874 GACTCTGTTCTCCTTCTGACAGG - Intergenic
1027775306 7:82457755-82457777 TCCCCCATTCTCCTTTTATCTGG - Intergenic
1028001051 7:85499108-85499130 CCTCCTATTTTCCATCTAACTGG - Intergenic
1032661943 7:133993813-133993835 GCCTCAATTCTCCTTTTATCAGG + Intronic
1035777973 8:2203938-2203960 GGCCCAAGTCTCCTTCTCACAGG - Intergenic
1038407777 8:27334763-27334785 GCCCCTATTCTAGTTGCAACTGG - Intronic
1038675262 8:29617119-29617141 GCCCCCATTCTCCCCCTAACTGG + Intergenic
1039830358 8:41208702-41208724 GCTCCTCTTTTCCTTCTACCAGG - Intergenic
1041475033 8:58255127-58255149 TACCCAATTCTCCTTCAAACTGG + Intergenic
1041979575 8:63841652-63841674 CCCCCTTTCCTCCTTCTCACAGG + Intergenic
1042581506 8:70284303-70284325 ACTCCTATTCTCCCTCTAAAAGG + Intronic
1043126743 8:76405876-76405898 GCCCCTCTTCTGCTTGAAACTGG - Intergenic
1044443537 8:92247636-92247658 GCCAATATTCTCTTTCTAAAAGG + Intergenic
1044729615 8:95219466-95219488 GGCCCTCTCCTCCTTCTCACTGG + Intergenic
1045156597 8:99481722-99481744 GTGCCTATACTGCTTCTAACTGG - Exonic
1048455429 8:134573980-134574002 TCCCCTCTTCCCTTTCTAACAGG - Intronic
1053203930 9:36170906-36170928 GCCCCTGCTCTCTTTCCAACAGG + Exonic
1057015286 9:91645564-91645586 GCACCGACTCTCCTTCTAAGAGG + Intronic
1058412113 9:104745582-104745604 TCTCCTATTCTCTTTCTCACAGG - Intergenic
1059560842 9:115333323-115333345 GCCCCTACTCTCCTGGTCACTGG - Intronic
1189725724 X:43966519-43966541 TCTCCTATTTTCCTTCTAAAGGG - Intronic
1195967157 X:110439133-110439155 GCCCCTCTTGTCCTTCTGTCGGG - Intronic
1197245639 X:124163818-124163840 CCCCATATTCTCCATCTAACTGG + Intronic
1200619704 Y:5427272-5427294 GCCCATGTTTTCCTTGTAACAGG + Intronic