ID: 909126451

View in Genome Browser
Species Human (GRCh38)
Location 1:71677141-71677163
Sequence TTGTTGGCCTTCTATAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909126450_909126451 -10 Left 909126450 1:71677128-71677150 CCAAGCTGGTGCATTGTTGGCCT No data
Right 909126451 1:71677141-71677163 TTGTTGGCCTTCTATAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909126451 Original CRISPR TTGTTGGCCTTCTATAATGA TGG Intronic
No off target data available for this crispr