ID: 909132406

View in Genome Browser
Species Human (GRCh38)
Location 1:71754341-71754363
Sequence GAAACGCTAATGTATCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909132406_909132408 15 Left 909132406 1:71754341-71754363 CCTTTAAGATACATTAGCGTTTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 909132408 1:71754379-71754401 CTTATGGTCCATTATTATTATGG No data
909132406_909132407 -1 Left 909132406 1:71754341-71754363 CCTTTAAGATACATTAGCGTTTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 909132407 1:71754363-71754385 CAGTGTTCTGCAATTGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909132406 Original CRISPR GAAACGCTAATGTATCTTAA AGG (reversed) Intronic
909132406 1:71754341-71754363 GAAACGCTAATGTATCTTAAAGG - Intronic
909287565 1:73838985-73839007 GAAAGGCTAAAGTAACTTCATGG + Intergenic
911456711 1:98133662-98133684 GAAATACTGATGGATCTTAATGG + Intergenic
913142198 1:115952715-115952737 CAGACGCTTATGTATCTTCAGGG + Intergenic
914339499 1:146747065-146747087 GAAAAGCTAATGCATGTTCATGG + Intergenic
923643377 1:235789377-235789399 GAAACTCTAATGTTTCTTTAAGG + Intronic
1064931245 10:20630106-20630128 GTAATGCTAATATATCTTATTGG - Intergenic
1074475069 10:113765409-113765431 GAATCTCTGATGTATTTTAATGG + Intronic
1087543824 11:99558080-99558102 GAAAAGGTAAGGTATCTCAAAGG + Intronic
1087586415 11:100127596-100127618 GAAAGCCAAATGAATCTTAATGG + Intronic
1089549457 11:119260586-119260608 TAAAAGCTAATGTTTTTTAAGGG - Intronic
1090469575 11:126968381-126968403 GAAAGGCTAATGTATCAGGACGG + Intronic
1094488205 12:30941602-30941624 CAAACACTATTGTAACTTAAGGG - Intronic
1094619129 12:32063232-32063254 CAAACGTGAATGTAGCTTAAAGG - Intergenic
1102379752 12:112454505-112454527 AAAACACTAATGTAACATAAAGG + Intronic
1104162825 12:126197101-126197123 GAAACTCAAATGTATCTCAAGGG + Intergenic
1104238000 12:126958418-126958440 CAAACTCAAATGTATCCTAATGG - Intergenic
1105691812 13:22848501-22848523 GACATGCTAATGTTACTTAATGG + Intergenic
1109010578 13:56936570-56936592 GTAATCCTATTGTATCTTAAAGG - Intergenic
1110670461 13:78170843-78170865 AAAAAGTTAATGTATGTTAAAGG - Intergenic
1111001977 13:82196360-82196382 GAAATAATAATGTATCTCAAAGG - Intergenic
1114283726 14:21219976-21219998 GAAAAGCAGATGGATCTTAAAGG - Intronic
1117131114 14:52687709-52687731 TAAATGCTAATGTGTTTTAAAGG + Intronic
1119277767 14:73374702-73374724 AAAAAGTTAATGTAACTTAAAGG - Intronic
1119888313 14:78163051-78163073 GAAAACATAATGTTTCTTAAAGG - Intergenic
1120012314 14:79430523-79430545 GAGAAGCTAATGAATCATAAAGG + Intronic
1122424495 14:101598058-101598080 CAAACCCTCATCTATCTTAAAGG - Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1126400721 15:48266981-48267003 GAAATGTTAATGTATTTGAATGG + Intronic
1127422560 15:58821158-58821180 GAAAAGTTAATATATGTTAATGG - Intronic
1131240340 15:90736242-90736264 GAAAAGAAAATGTATCTTTAGGG - Intronic
1131365582 15:91836663-91836685 GAAAAGTTAATATATATTAAAGG - Intergenic
1139994784 16:70970343-70970365 GAAAAGCTAATGCATGTTCATGG - Intronic
1148857888 17:50588922-50588944 GACACCCAAATGTATCCTAATGG - Intronic
1149682577 17:58516426-58516448 GAAACCCTAATTTATCTCCAGGG + Intronic
1155139245 18:23029068-23029090 AAAAAGATAATGTATATTAAAGG + Intergenic
1155605708 18:27603134-27603156 GAACTGCTAATGGATCTTTAAGG + Intergenic
1156863206 18:41862395-41862417 GAAATGCTTATGTATGTTGAGGG + Intergenic
1157087406 18:44595704-44595726 GAAAAGCTAATATATATTTATGG - Intergenic
1157633554 18:49126054-49126076 TAAATACTTATGTATCTTAATGG - Intronic
1164659008 19:29946654-29946676 GAACAGCTAATTTAACTTAATGG + Intronic
1165098738 19:33425602-33425624 GAAGCGCTAATGTCTGTTAATGG + Intronic
1165935678 19:39387292-39387314 GATACGGTATTCTATCTTAAGGG + Intronic
927490456 2:23517845-23517867 GGAAGGCCAATGTATCTTAGAGG - Intronic
936879690 2:117234572-117234594 GAAAGTCTAAGGTATCTTGATGG - Intergenic
945335715 2:208590645-208590667 GAAATGCCAATGTATCTAAATGG + Intronic
947648404 2:231762687-231762709 GCAACGCAAAATTATCTTAATGG + Intronic
948606265 2:239137545-239137567 GAAACACTACTGTACCTTGAAGG - Intronic
1170096768 20:12654223-12654245 AAAATGCAAATGTATCTTCAGGG + Intergenic
1177419231 21:20834482-20834504 GAAATGCTTTTGTATCTTAAAGG + Intergenic
1177753996 21:25322592-25322614 GATAAGCTAATGTATTTTATTGG - Intergenic
1182789718 22:32941087-32941109 GAAACCCTCACTTATCTTAAAGG + Intronic
1182821445 22:33220122-33220144 GAACCGCTAACCTATCTTAATGG + Intronic
950924837 3:16730256-16730278 TAAAAGCTAAAGTATATTAAAGG - Intergenic
952200350 3:31120037-31120059 AAAAAACTGATGTATCTTAAGGG - Intergenic
957189832 3:76993350-76993372 GAAATTCAAATGTATCTTAGAGG + Intronic
958509564 3:95029273-95029295 GAATCACCTATGTATCTTAATGG - Intergenic
959201509 3:103253826-103253848 GAAATGCTAATGTAATTTTAGGG - Intergenic
959626024 3:108452332-108452354 GAAACTCTTATGTATATGAATGG + Intronic
960437865 3:117649044-117649066 GAAATGTTAATGTGTCTTGATGG + Intergenic
961104775 3:124231655-124231677 AAAATGTTAATGTATTTTAATGG - Intronic
962614233 3:137108933-137108955 GAAATGCTAATCCATCTTTAAGG + Intergenic
963815227 3:149822911-149822933 GAAAAACTAATGTATATTAATGG - Intronic
970848856 4:20577503-20577525 TAATGGCTAATGTATCTTACTGG + Intronic
974516577 4:62922026-62922048 GGAATACTAATGTATCTTCATGG + Intergenic
976136267 4:81939577-81939599 CAAACACTAATGTATCTAATGGG + Intronic
976518288 4:85996828-85996850 GAAATGCTAATTTATCATCATGG - Intronic
977386298 4:96343881-96343903 AAAAACATAATGTATCTTAAGGG + Intergenic
977690212 4:99897998-99898020 GACATGCTAATGTTACTTAATGG - Exonic
980908473 4:138972346-138972368 GAAACGTTGATGTATCTTTCAGG - Intergenic
982433171 4:155347537-155347559 TAAAATCTTATGTATCTTAATGG + Exonic
983030693 4:162798108-162798130 TCAAAGCTAATGTATCTTACAGG + Intergenic
983997197 4:174197147-174197169 TAAAAGCTACTTTATCTTAAAGG - Intergenic
991518215 5:67463978-67464000 GAAAGGCTAATCTTACTTAAGGG + Intergenic
992366960 5:76102187-76102209 GAATTGCTAATTTATATTAAGGG - Intronic
993661154 5:90636550-90636572 TAAAAGCTAATTTTTCTTAAGGG - Intronic
994966750 5:106682524-106682546 GAGACATTAATGTCTCTTAATGG + Intergenic
995595149 5:113739739-113739761 GGAAAGCTAAGGTTTCTTAATGG - Intergenic
996436623 5:123440425-123440447 GAAACGCAAATATATCGTACAGG + Intergenic
998381550 5:141729581-141729603 GAAACGCTAATTGGTGTTAATGG - Intergenic
1001779441 5:174355212-174355234 GAAATGCAAGTGTATCTTACAGG - Intergenic
1008127861 6:47689242-47689264 GAAGTGCCAATGTATCTTCACGG + Intronic
1008320672 6:50109135-50109157 GAAACTCTAATTTATCTTGGTGG - Intergenic
1012726587 6:102820207-102820229 GAAAGGATAATTTATCTTGAAGG + Intergenic
1013975929 6:116078464-116078486 TAATAGCTAATGTATGTTAAGGG + Intergenic
1015200446 6:130573922-130573944 AAAAAGATAATGTATGTTAAAGG - Intergenic
1017319989 6:153079699-153079721 GAATAGCTAATATATTTTAAAGG + Intronic
1022997933 7:35777215-35777237 GAAATGCTATTTTTTCTTAATGG + Intergenic
1030241871 7:107335972-107335994 AAAACGTTAACGTATCTAAAAGG + Intronic
1030699003 7:112618219-112618241 GAAAAGGTAATGAATCTTCATGG - Intergenic
1032484319 7:132272719-132272741 GAAACATTACTGTGTCTTAAGGG - Intronic
1032527627 7:132591741-132591763 GCAACACTAATGCATCTGAAAGG - Intronic
1032763402 7:134966358-134966380 GAAAGGCTAGTGGATTTTAATGG - Intronic
1039565693 8:38551103-38551125 GAAACGCACATGAATCGTAAAGG + Intergenic
1041634953 8:60132538-60132560 GAAATGTTAATGTATGTTGATGG - Intergenic
1042882302 8:73507138-73507160 GAATCACAAATGTATCTTAATGG + Intronic
1045033536 8:98160071-98160093 GAAATGCTAATCTATCTTTCTGG - Intergenic