ID: 909136672

View in Genome Browser
Species Human (GRCh38)
Location 1:71809865-71809887
Sequence TGTCTGTTAGGATCACAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909136672_909136676 26 Left 909136672 1:71809865-71809887 CCAACCTGTGATCCTAACAGACA No data
Right 909136676 1:71809914-71809936 AACGTAAAAGTTTTGCATGAAGG No data
909136672_909136675 -1 Left 909136672 1:71809865-71809887 CCAACCTGTGATCCTAACAGACA No data
Right 909136675 1:71809887-71809909 AAATTGCTTTAAGCAAGTCAAGG 0: 1
1: 1
2: 1
3: 22
4: 275
909136672_909136677 27 Left 909136672 1:71809865-71809887 CCAACCTGTGATCCTAACAGACA No data
Right 909136677 1:71809915-71809937 ACGTAAAAGTTTTGCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909136672 Original CRISPR TGTCTGTTAGGATCACAGGT TGG (reversed) Intronic
No off target data available for this crispr