ID: 909140596

View in Genome Browser
Species Human (GRCh38)
Location 1:71859663-71859685
Sequence TGCATACTATGTTGGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909140596_909140602 20 Left 909140596 1:71859663-71859685 CCCTAGATCCAACATAGTATGCA No data
Right 909140602 1:71859706-71859728 GTCAGCTTCTTGCCACATTTGGG No data
909140596_909140603 21 Left 909140596 1:71859663-71859685 CCCTAGATCCAACATAGTATGCA No data
Right 909140603 1:71859707-71859729 TCAGCTTCTTGCCACATTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 167
909140596_909140601 19 Left 909140596 1:71859663-71859685 CCCTAGATCCAACATAGTATGCA No data
Right 909140601 1:71859705-71859727 TGTCAGCTTCTTGCCACATTTGG 0: 1
1: 0
2: 0
3: 8
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909140596 Original CRISPR TGCATACTATGTTGGATCTA GGG (reversed) Intronic
No off target data available for this crispr