ID: 909140816

View in Genome Browser
Species Human (GRCh38)
Location 1:71863019-71863041
Sequence CACCATACTCTCTTCTACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909140816_909140818 -5 Left 909140816 1:71863019-71863041 CCATTGTAGAAGAGAGTATGGTG No data
Right 909140818 1:71863037-71863059 TGGTGATTCCTCAAGGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909140816 Original CRISPR CACCATACTCTCTTCTACAA TGG (reversed) Intronic