ID: 909148924

View in Genome Browser
Species Human (GRCh38)
Location 1:71975413-71975435
Sequence TAGATTAGGAAGGACATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909148921_909148924 -3 Left 909148921 1:71975393-71975415 CCTAAAGAAGTACAGATAATTAG 0: 1
1: 0
2: 2
3: 36
4: 371
Right 909148924 1:71975413-71975435 TAGATTAGGAAGGACATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909148924 Original CRISPR TAGATTAGGAAGGACATGAT AGG Intronic
No off target data available for this crispr